Potential of CLSPN as a therapeutic target in melanoma: a key player in melanoma progression and tumor microenvironment

Abstract

Background

Melanoma is a highly aggressive form of skin cancer. Despite significant advances in targeted therapies and immunotherapeutic approaches, some patients still have poor response rates, making a deeper understanding of melanoma pathogenesis essential.

Methods

The expression of Claspin (CLSPN), prognosis and immune infiltration in skin cutaneous melanoma patients were analyzed by public databases. Immunohistochemistry was used to validate. Moreover, quantitative real-time polymerase chain reaction analysis, western blot, cell counting kit-8 assay, colony formation assay, flow cytometry, animal experiments, and RNA-seq were applied to explore its biological functions and potential molecular mechanisms of CLSPN in melanoma.

Results

Our results demonstrated that abnormal CLSPN expression was correlated with poor prognosis in melanoma. Meanwhile, CLSPN may promote melanoma growth and progression in vivo and in vitro through IFI44L/JAK/STAT1 signaling. Additionally, CLSPN was associated with negative immune microenvironment in melanoma and may be related to polarization of tumor associated macrophages towards M2-type.

Conclusions

These findings suggest that CLSPN may be a promising new target for melanoma and accelerate personalized therapeutic strategies.

Graphical abstract

Introduction

Skin cutaneous melanoma (SKCM) is recognized as one of the most life-threatening and aggressive types of cancer [1]. Recently, the occurrence of SKCM has been on the rise globally, which contributes to about 72% of deaths from skin carcinoma [2–3]. Despite great advances in targeted and immune therapies for melanoma, its overall survival remains low [4]. In addition, a significant proportion of melanoma patients exhibit low response rates, which may be related to the tumor microenvironment (TME) [5, 6]. Therefore, exploring interactions between tumor cells and TME in SKCM is of great benefit to identify new therapeutic targets.

Claspin (CLSPN) is a protein crucial for cell cycle checkpoints and responding to DNA damage. It is initially extracted and identified from the eggs of the African clawed frog [7–8]. Degradation of CLSPN is required to induce apoptosis when DNA damage is irreversible [9–10]. As a result, CLSPN is essential for accurate genome replication and supporting the initiation and conclusion of DNA damage repair. Research indicates that mutations in the CLSPN gene are linked to an increased risk of cancer and tumor development [11–12], making the in-depth study of CLSPN’s role in tumors essential. Studies have confirmed that CLSPN is involved in the pathogenesis of many kinds of tumors. Co-expression of CLSPN with CD44 and PD-L1 (CD274) promotes progression of renal cell carcinoma, highlighting its potential as a new treatment target [13]. The latest research in oral squamous cell carcinoma indicates that CLSPN can promote glycolysis and tumor proliferation by activating the Wnt/β-catenin signaling pathway [14]. In addition, CLSPN promotes several human solid tumors, including liver, gastric, and ovarian clear cell carcinoma [15,16,17]. In summary, the CLSPN gene is closely correlated with cancer and may affect the development and therapeutic response of cancer through multiple mechanisms.

However, the changes and specific functions of CLSPN in melanoma are not well understood. Recently, study demonstrated that the expression of CLSPN by picrasidine I, a natural compound derived from plants, could be investigated further as a potential biomarker to predict its efficacy in melanoma [18]. These results implied that CLSPN may be involved in melanoma development, but the exact mechanism is still unknown. Meanwhile, considering that low response to immunotherapy in some melanoma patients may be related to the tumor microenvironment [19–20], and preliminary research has revealed that CLSPN also affects TME. Investigations imply that CLSPN modulates the infiltration of immune cells in tumor tissue via immune regulatory mechanisms [21,22,23]. However, the role of CLSPN in the TME of melanoma is not clear. Understanding how CLSPN interacts with TME could reveal new targets for immunotherapy.

In this study, we confirmed the critical role of CLSPN in melanoma development and found that it promoted the JAK/STAT1 pathway by activating IFN-induced protein 44-like (IFI44L) transcription. Additionally, CLSPN contributes to the suppression of the TME by enhancing TAMs polarization towards the M2 phenotype. Our study provides novel targets and insights for the immunotherapy for SKCM.

Materials and methods

Bioinformatics analysis

In this study, we assessed the differential expression of CLSPN in 34 types of tumor tissues from The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression Project (GTEx) databases. RNA-seq data from TCGA and GTEx were processed uniformly using the Toil process [24] and then log2-transformed. The analysis of statistics was conducted with the Wilcoxon rank-sum test, marking significance at p < 0.05. The Gene Expression Profiling Interactive Analysis 2 (GEPIA2) (http://gepia2.cancer-pku.cn/) was used to investigate the expression levels of CLSPN in patients with SKCM [25]. Kaplan-Meier curves were used to examine the correlation between CLSPN expression and the overall survival (OS) and disease-free survival (DFS) of SKCM patients. Kaplan-Meier curves were created using GEPIA2 using the log-rank test, with a p-value < 0.05 regarded as significant.

Cell culture and chemicals

The melanoma cell lines A375, A2058 were obtained from the American Type Culture Collection and were grown in Dulbecco’s Modified Eagle Medium (DMEM, BI, USA). Every cultured cell was provided with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin-streptomycin (BI, Shanghai XP Biomed Ltd, China). Cells were cultured at 37 °C in 5% CO2 incubator (Thermal Fisher Inc, USA). Z-VAD-FMK, a cell-permeable pan-caspase inhibitor, was purchased from MedChemExpress (HY-16658, MCE, China). CGP-52,411 (HY-103442, MCE, China) and TAK-715 (HY-10456, MCE, China) were purchased from MCE. Subsequent experiments were carried out after 24 h pre-treated with CGP-52,411 or TAK-715.

Cell transfection

The sequences of si-CLSPN were as follows: si-CLSPN1 sense, GAGUCAUUAGAAUCAAUAAGA; si-CLSPN1 antisense, UUAUUGAUUCUAAUGACUCUU; si-CLSPN2 sense, GCAGAUAGUCCUUCAGAUAGU; si-CLSPN2 antisense, UAUCUGAAGGACUAUCUGCUU; si-CLSPN3 sense, GGUUCUACAAGACAGUGAUUC; si-CLSPN3 antisense, AUCACUGUCUUGUAGAACCUU. Lipofectamine 3000 (Invitrogen, USA) was used to facilitate transfection. Experimental procedures were performed at least 48 h following transfection. In addition, a shRNA sequence targeting the CLSPN gene was designed and integrated into the lentiviral GV493 vector (Genechem, China). Puromycin was used to select cell lines with stable gene expression, and the efficiency of transfection was also validated using western blotting and qRT-PCR.

Cell proliferation assay

Cell proliferation was measured by CCK-8 assay. A375 and A2058 cells were seeded at a density of 2500 cells/well in the 96-well plates. After culture for 0, 24, 48, or 72 h, cells with 90 µL of high-glucose DMEM were exposed to 10 µL CCK-8 reagent (Solarbio, Beijing, China). The optical density (OD) values were measured using a synergy H1 microplate reader (BIOTEK, Vermont, USA) at 450 nm after 1 h. Three independent experiments were carried out, with three replicate wells evaluated in each group.

Colony formation assay

A2058 and A375 cells were seeded in 6-well plates at a density of 1000 cells per well and transfected with si-CLSPN for 48 h. Subsequently, the cells were allowed to culture for 2 weeks at 37 ℃. And then, the cells were fixed by 4% fixative solution (Solarbio, China) for 20 min after washed with phosphate buffered saline (PBS; Servicbio, China) three times. Next, we stained them with crystal violet (Beyotime Biotechnology, China) for 10 min, and counted them.

Detection of cell apoptosis

Cell apoptosis was detected by an apoptosis detection kit (Vazyme, China). After transfected si-CLSPN for 48 h, A375 and A2058 cells were digested with EDTA-free trypsin and washed with PBS. 1 × 10^5 cells were in a 195 µL volume of 1 × binding buffer. Following this, it was treated with 5 µL of Annexin V-FITC and 10 µL of PI at ambient temperature in the absence of light for a duration of 15 min. Subsequently, 400 µl of 1x binding buffer was included in each test tube and gently mixed well. Cell apoptosis was quantified through a flow cytometer (Beckman Coulter, USA) within 1 h.

qRT-PCR

Total RNA extraction was performed with the Trizon reagent (Cwbio, China). A NanoDrop One spectrophotometer (Thermo Fisher Scientific, USA) was used to measure the RNA concentration. Reverse transcription and gene amplification were performed using the PrimeScript RT kit (Takara, Japan). qRT-PCR was conducted by TB Green^® Premix Ex TaqTMIIKit (Takara, Japan) according to the manufacturer’s instructions. The 2^−△△CT method with normalization to β-actin was used to calculate the relative expression of the mRNA. The primers sequences were presented in Table 1.

Table 1 The primers sequences

Western blot

Total protein was extracted in RIPA lysis buffer (EpiZyme Biotechnology, Shanghai, China) containing phosphatase and protease inhibitor cocktail (NCM Biotech, Shanghai, China). A BCA kit (Beyotime, P0010) was used for measuring the cellular protein content. Afterwards, 10% SDS-PAGE was applied to separate proteins, and the proteins were transferred to polyvinylidene difluoride membranes (Millipore, USA). The membranes were blocked using 5% non-fat milk for 1 h, incubated overnight with primary antibodies against CLSPN (Affinity, DF7525), IFI44L (SAB, 27948), p-STAT1 (Proteintech, 28977-1-AP), STAT1 (Proteintech, 10144-2-AP), XAF1 (BOSTER, BA4986), GAPDH (Affinity, AF7021), anti-Bax (Cell Signaling Technology, #5023), anti-Bcl-2 (Cell Signaling Technology, #3498), anti-cleaved-PARP (Cell Signaling Technology, #5625T), anti-cleaved-caspase 9 (Cell Signaling Technology, #20750), anti-β-tubulin (Affinity, AF7011), anti-β-actin (Affinity, #AF7018) at 4 ℃, and then incubated for 1 h with secondary antibody goat Anti-Rabbit IgG (Affinity, #S0001). Membranes were treated with Pierce ECL Plus Western Blotting Substrate (Thermo Fisher Scientific, USA). The protein signals were detected and imaged using ChemiDOCTM Imaging System (BIO-RAD, USA). The intensity of the proteins was measured using ImageJ (edition 1.8.0; National Institutes of Health, Bethesda, MD, US).

Immunohistochemical staining (IHC) and hematoxylin-eosin staining (HE)

IHC and HE were performed according to previous description. Tissues were embedded using paraffin and cut into 5 μm sections. The tumor tissues were fixed with 4% paraformaldehyde (PFA), dehydrated, permeabilized, embedded in paraffin, fixed in the wax block, and prepared into sections. Thereafter, the paraffin sections were subjected to deparaffinization, hydration, staining, blue staining, dehydration, permeabilization and sealing in succession according to the routine HE staining steps. Images were taken by a microscope.

TUNEL assay

A TUNEL assay kit (CX107L, Yamei Cellorlab, China) was used to detect apoptotic cells according to the manufacturer’s instructions. Nuclei were stained with DAPI. The TUNEL-positive cells were assessed in randomly selected tumor regions of the slides. Images were captured using an inverted fluorescence microscope.

RNA sequencing, data processing and gene difference analysis of A2058 cells

According to standardized protocols, total RNA was isolated for RNA sequencing (RNAseq) analysis. Agilent Technologies’ 2100 Bioanalyzer (Santa Clara City, California, USA) was used to assess the RNA integrity. The resulting library was subjected to sequencing using an Illumina Novaseq 6000 platform. Subsequently, RNA sequencing libraries were constructed using the V6 RNA-seq library preparation kit following VAHTS general instructions. All experimental protocols and data analyses were performed by Paisennuo (Shanghai, China).

Protein structure and protein Docking

The protein models used for docking were CLSPN (Uniprot ID: Q9HAW4) and IFI44L (Uniprot ID: Q53G44). Protein-protein molecular docking was performed using the HDOCK SERVER (http://hdock.phys.hust.edu.cn/). Protein preprocessing was carried out using PyMol 2.4, including the removal of water molecules and unnecessary ligands, and the addition of hydrogen atoms. The docking results were evaluated based on the Docking Score, Confidence Score, and Ligand RMSD. The top 10 docking positions were outputted, with the highest-scoring model selected as the best docking model. Finally, the docking results were visualized using PyMol 2.4, allowing for a clear observation of the protein-protein interactions.

Immune characteristics analysis

We used ssGSEA algorithm and TCGA database (https://portal.gdc.cancer.gov) to explore the potential association between the CLSPN expression level and immune cells. Markers of immune cells were provided in the Immunity article [26–27]. Lollipop chart was plotted to examine the correlation of CLSPN with immune cells infiltration in SKCM. To compare the levels of immune cell infiltration, the specimens were divided into high CLSPN group and low CLSPN group, according to the median expression level of CLSPN. And the abundance of eight tumor-infiltrating immune cells, including B cells, cytotoxic cells, DC, NK cells, T cells, TFH, Th17, Treg cells, was explored. The relationship between CLSPN expression and macrophages were determined using the TIMER2.0 (http://cistrome.org/TIMER/). Correlation analysis between CLSPN and chemokines affecting monocytes/macrophages in SKCM was explored by TCGA database, and the Spearman correlation was calculated.

Animal experiments

This study was approved by the Medical Experimental Animal Care Committee of Shanghai Skin Disease Hospital. Female BALB/c-nu mice (6–8 weeks old) were sourced from Sibeifu Biotechnology Co., Ltd (Jiangsu, China). Mice were kept at 12 h/12 hrs light cycle and received standard food and water. Mice were randomly divided into the two groups (n = 4). A375 melanoma cells with or without the knockdown of CLSPN (1 × 10⁶/200 µL) were subcutaneously inoculated into the right flank of mice. Mice were examined of the volumes of the tumors at indicated time points. Five weeks later, the mice were sacrificed and the tumors were harvested and photographed, and the weights of tumors were examined as well. Tumor tissues were separated and embedded with paraffin for IHC staining and analysis.

Statistical analysis

The survival analyses in this study were determined by Kaplan–Meier curve and log-rank test. To investigate the correlation between CLSPN expression and the abundance of tumor infiltrating immune cells, Wilcoxon rank sum and Spearman rank correlation tests were used to calculate p values in GSVA package. Student’s t-test was applied for comparison of two groups and one-way analysis of variance (ANOVA) was applied for comparison of multiple groups. P-value < 0.05 indicated statistical significance.

Results

CLSPN expression is positively associated with tumor progression in melanoma patients

To explore the function of CLSPN in melanoma, we firstly identified the expression of CLSPN mRNA in pancancer from TCGA + GTEx database. The results showed CLSPN was expressed at higher levels in the majority of tumors than in normal tissues (Fig. 1A). Next, we analyzed the RNA sequencing data from TCGA + GTEx SKCM cohort. The findings demonstrated that CLSPN expressed higher in SKCM tumor tissue than normal tissue (Fig. 1B). Subsequently, clarification was done for the relationship between CLSPN gene expression and clinical significance in SKCM. Overall survival (OS) curve and disease-free survival (DFS) curve revealed that patients with higher CLSPN expression received a worse prognosis (Fig. 1C-D). We then performed the immunohistochemical (IHC) staining in SKCM tissue sections to quantify CLSPN protein expression. The data demonstrated that CLSPN protein expression levels were increased in SKCM than normal skin tissue and benign naevus. Furthermore, we validated CLSPN protein levels in A375 and A2058 melanoma cell lines. Results proved that CLSPN expression was remarkably increased in these two melanoma cell lines (Fig. 1F). Therefore, our results indicated that CLSPN could be a crucial gene in the development of SKCM.

Fig. 1

CLSPN expression is positively correlated with tumor progression in SKCM patients. (A) CLSPN expression levels in different cancer types based on TCGA + GTEx database. (B) The mRNA expression of CLSPN in SKCM and normal tissues, derived from the GEPIA 2.0 database. (C-D) Kaplan-Meier curve analyses overall survival and disease free survival curve of CLSPN in SKCM, derived from the GEPIA 2.0 database. (E) Immunohistochemical staining of CLSPN in normal skin tissues, benign naevus tissues and melanoma tissues, scale bar = 200 μm. (F) The protein expression levels of CLSPN in HaCaT, A375 and A2058 cell lines by western blot. * p < 0.05

CLSPN promotes the malignant phenotype of melanoma

To examine the molecular roles of CLSPN in melanoma cells, CLSPN-knockdown A375 and CLSPN-knockdown A2058 were generated. qRT-PCR and western blot were used to confirm the transfection efficiency. We found that CLSPN was knocked down effectively (Fig. 2A-B). Subsequently, CCK-8 assay was performed to examine the influence of CLSPN on the cellular viability of A375 and A2058 cells. The outcomes revealed a concomitant diminution in the viability of cells with reduced CLSPN expression in both cell lines (Fig. 2C). Furthermore, the colony formation assay demonstrated that the suppression of CLSPN expression resulted in a significant decrease in the colony forming ability (Fig. 2D). As a pan-apoptotic inhibitor, zVAD was used to exclude the effects of apoptosis in the scratch assay. The results demonstrated that knockdown of CLSPN in the A375 and A2058 cell lines inhibited their migratory ability when the effect of apoptosis was excluded (Fig. 2E). In addition, our results also revealed that silenced for CLSPN in A375 and A2058 could increase their apoptosis rate (Fig. 3A-B). The expression of anti-apoptotic protein Bcl-2 and pro-apoptotic protein Bax were detected. The ratio of Bax/ Bcl-2 showed knockdown CLSPN caused an increased Bax/ Bcl-2 ratio (Fig. 3C-D). We also detected the protein expression of cleaved-PARP and cleaved-caspase-9, which are important indicators of cell apoptosis. Consistently, these apoptosis-related markers were up-regulated, indicating the apoptosis induction was increased. These results indicate that CLSPN contributes to the malignancy of melanoma cells.

Fig. 2

CLSPN promotes the proliferation, migration of melanoma cells. (A-B) The mRNA and protein expression levels of CLSPN in A375, A2058 cell lines after si-CLSPN transfection. (C) Cell viability of A375 and A2058 after knockdown of CLSPN. (D) Colony formation analysis of A375 and A2058 after knockdown of CLSPN. (E) Representative images of migration in A375 and A2058. Cells were pretreated with 20 µM zVAD for 2 h and then subjected to CLSPN knockdown. Data were expressed as mean ± SD. * p < 0.05, ** p < 0.01 and *** p < 0.001

Fig. 3

CLSPN knockdown promotes the apoptosis abilities of melanoma cells. (A-B) Cell apoptosis in A375 and A2058 after CLSPN knockdown by the flow cytometry with quantitative assessment. (C) The protein levels of Bcl-2, Bax of A375 and A2058 cells after si-CLSPN transfection measured by western blot. (D) The Bax/Bcl-2 ratio of A375 and A2058. (E) The protein expressions of cleaved-caspase-9 and cleaved-PARP, and the quantitative analysis of their expressions in A375 and A2058 cells after si-CLSPN. Data were expressed as mean ± SD. * p < 0.05, ** p < 0.01 and *** p < 0.001

RNA sequencing investigates the function and potential signaling pathway of CLSPN

To elucidate the role of CLSPN and the potential downstream pathway in melanoma cells, we performed RNA sequencing on CLSPN knockdown and control A2058 cells. Analysis of the sequencing data revealed 878 differentially expressed genes (DEGs), characterized by log2|FC| > 1.2 and p < 0.05. The volcano plot highlights several DEGs including the upregulated genes, IFI44L, CEMIP2, and PDK1, while NDUFA4 and WARS1 were notably downregulated (Fig. 4A). Additionally, KEGG pathway enrichment analysis identified several significantly enriched pathways, including the HIF-1 signaling pathway and PPAR signaling pathway (Fig. 4B). Subsequently, analysis of PPI networks revealed that IFI44L, IFIT1 and MX1 occupied central nodes in the PPI network (Fig. 4C). Considering that IFI44L was most significant in DEGs and protein interactions analysis, we subsequently detected the interactions between CLSPN and IFI44L. Molecular docking between CLSPN and IFI44L was carried out. Docking score was − 223.08 and the confidence score was 0.81, indicating that CLSPN might correlated with IFI44L (Fig. 4D). Therefore, we verified mRNA and protein expression of IFI44L after knockdown of CLSPN in melanoma cells. Consistent with the sequencing results, IFI44L expression was elevated after CLSPN reduction.

Fig. 4

RNA sequencing of A2058 cells to investigate the function of CLSPN. (A) Volcano plot of the differential gene expression between CLSPN knockdown group and the control group. The red points represented significantly up-regulated gene, and the blue points represented significantly down-regulated gene. (B) The top 20 enrichment of KEGG pathway terms analysis for the differential genes.(C) Protein-protein interaction analysis of differentially expressed functional genes. (D) Molecular docking result of CLSPN/IFI44L. (E) The mRNA expression of IFI44L and downstream genes after CLSPN knockdown in A2058 by qPCR. (F) The protein levels of CLSPN, IFI44L, p-STAT1, STAT1 and XAF1 after si-CLSPN transfection by western blot. (G) The quantification results of western blot by Image J (n = 3). Data were expressed as mean ± SD. * p < 0.05 and ** p < 0.01

CLSPN modulates the IFI44L-mediated JAK/STAT1 pathway

Previous research reported that IFI44L could activate the JAK/STAT1 pathway. Therefore, we detected the related gene expression including STAT1, XAF1, OAS1, OAS2, OAS3 after CLSPN knockdown. Our results showed that these genes were upregulated after si-CLSPN. Meanwhile, the protein level of p-STAT1 was also upregulated, indicating that JAK/STAT1 pathway was activated in A2058 cell line (Fig. 4E-F).

CLSPN- knockdown inhibits tumor growth and proliferation in mouse models

To validate the function of CLSPN in vivo, we established melanoma xenograft mouse models. We found tumor growth was significantly inhibited after knockdown of CLSPN (p < 0.05) (Fig. 5A-C). Histological analysis revealed that positive expression of Melan A and SOX10 confirmed that tumor tissues in both of sh-NC and sh-CLSPN groups were melanomas. Furthermore, downregulation of CLSPN significantly suppressed tumor cell proliferation, as indicated by the Ki-67 positivity index. TUNEL assay demonstrated that the apoptosis cells were increased in sh-CLSPN group compared to control group (Fig. 5D).

Fig. 5

CLSPN knockdown inhibits tumor growth in vivo. (A) The pictures of tumors derived from mouse model. (B) The tumor weight in different groups. (C) The tumor volume in different groups. (D) Representative figures staining with HE, immunohistochemical staining of Melan A, SOX 10, Ki-67 (100 μm for scale bar). TUNEL assay, original magnification: 40×, scale bar = 50 μm. Data were presented as mean ± SD. *p < 0.05

The role of compounds was explored in melanoma based on cMAP prediction

A list of compounds was obtained by uploading the gene symbols of DEGs to the cMAP database. The top compounds with the highest scores include CGP-52,411, TAK-715 and tanespinmycin (Fig. 6A; Table 2). Tanespinmycin had been reported to significantly reduce the proliferation rates and migration ability of uveal melanoma cell lines [28]. Therefore, we explored the role of CGP-52,411 and TAK-715 in melanoma cell lines, A2058 and A375. The results showed that CGP-52,411 and TAK-715 decreased cell viability in a dose-dependent manner (Fig. 6B-C). 10 μM CGP-52,411 and 25 μM TAK-715 could reduce the cell activity by about half in A375. These two concentrations were chosen for subsequent studies. Similarly, 15 μM CGP-52,411 and 125 μM TAK-715 were used for subsequent studies in the A2058 cell line. The results revealed that CGP-52,411 and TAK-715 reduced the colony formation ability and migration of these two cell lines (Fig. 6D-F). In addition, these two compounds could increase A375 cell apoptosis (Fig. 6G). Therefore, we indicated that CGP-52,411 and TAK-715 could inhibit the melanoma tumor phenotype.

Fig. 6

The role of compounds in melanoma based on cMAP prediction. (A) Chemical formula structure diagrams of the 3 top compounds with the highest scores in the cMAP analysis. The inhibitory effects of different CGP-52,411 and TAK-715 concentrations on A375 (B) and A2058 (C) after incubation for 24 h. The effects of CGP-52,411 and TAK-715 on A375 (D) and A2058 (E) colony formation. (F) Representative images of migration in A375 and A2058 after CGP-52,411 and TAK-715 treated. (G) Cell apoptosis in A375 after CGP-52,411 and TAK-715 treated. cMAP, connectivity map. Data were expressed as mean ± SD. *** p < 0.001

Table 2 The top componds with the highest scores in the CMap analysis

CLSPN is associated with immune microenvironment suppression in melanoma

In our subsequent investigation, we analyzed the link between CLSPN expression and the presence of immune cells within tumors. Examination of the TCGA-SKCM cohort demonstrated that CLSPN expression inversely correlated with most immune cells, implying a suppressive effect of CLSPN on tumor immune microenvironment (Fig. 7A). Consistently, immune infiltration analysis utilizing the ssGSEA algorithm revealed that elevated CLSPN expression corresponds to a diminished infiltration of cytotoxic cells, DC, NK cells, Tfh cells, Th17 cells and Treg cells (Fig. 7B). Although the differences in B and T cell infiltration were not statistically significant, a similar trend was noted, further underscoring the detrimental role of CLSPN in the tumor immune microenvironment. Concerning the association between CLSPN and macrophage polarization in SKCM, our data indicated a significant positive correlation between CLSPN expression and the presence of M2 macrophages, whereas no significant association was found with M1 macrophages (Fig. 7C). We extended to examining the expression of chemokines that impact monocytes/macrophages concerning CLSPN (Fig. 7D). The results highlighted a significant correlation between CLSPN and the expression levels of CCL2, CCL7, and CCL8 chemokines.

Fig. 7

CLSPN is associated with immune microenvironment suppression in melanoma. (A) The lollipop plot illustrated the correlation between CLSPN expression and the infiltration of various immune cells. (B) Violin plot demonstrated analysis of ssGSEA-based immune infiltration algorithm between high and low CLSPN expression groups. (C) The correlation between CLSPN expression and the infiltration of M1 and M2 Macrophages in skin melanoma by CIBERSORT algorithm. (D) A heatmap depicted the correlation between CLSPN expression levels and the expression of key chemokines of monocytes and macrophages.

Discussion

Although there have been considerable improvements in SKCM diagnosis and therapies, the prognosis for advanced malignant SKCM continues to be bleak [29]. Discovering new molecular markers for SKCM and developing effective treatment strategies could enhance disease outcomes. In the present study, our study confirmed the role of CLSPN in melanoma and also revealed that the relationship between CLSPN and the TME may influence the prognosis of immunotherapy for melanoma.

Prior investigations found that HAS3-extracellular vesicles might drive the proliferation of melanoma cell lines through c-Myc and CLSPN [30]. Consistently, our functional study revealed that knockdown of CLSPN attenuated melanoma cells proliferation and induced apoptosis in vitro and in vivo. Moreover, our results also showed that CLSPN expression was upregulated in SKCM and had a close relationship with the prognosis of melanoma patients. Previous studies revealed that CLSPN level was negative associated with CD8 + T cells, CD4 + T cells, NK cells, and macrophage cell infiltration in LUAD [31]. However, whether CLSPN could influence tumor immune microenvironment of SKCM remained unknown. Our results showed that CLSPN showed a significant positive correlation with Th2 cells. An imbalance in the Th1/Th2 ratio due to an increase in Th2 cells could significantly weaken the body’s anti-tumor immune response, resulting in malignant tumor growth [32–33]. These findings indicated that CLSPN might lead to a state of immunosuppression by affecting Th2 polarization, causing tumor cells to evade immune detection. Meanwhile, we found CLSPN level in SKCM was negative associated with most immune cells, including CD8 + T cells, NK cells infiltration. Furthermore, high CLSPN expression in SKCM was related to lower cytotoxic cells, DC, NK cells infiltration. Taken together, CLSPN might play a negative regulatory role in the SKCM tumor immune microenvironment. Targeting to CLSPN may provide us with ideas for adjuvant immunotherapy in SKCM.

Mechanistically, our results suggested that IFI44L was elevated after knockdown of CLSPN. IFI44L is a type I interferon-stimulated gene, which has been reported to be involved in immune processes. It had been revealed that IFI44L can regulate the met/Src signaling pathway and affect the progression of hepatocellular carcinoma, which has potential value for prognosis [34]. In lung cancer, the immune implications and prognostic value of IFI44L have been investigated and it acted as a novel epigenetically silenced tumor suppressor that promotes apoptosis and exerts tumor suppressor effects through JAK/STAT1 pathway [31]. Our results demonstrated that CLSPN might be involved in melanoma development and invasion by activating IFI44L and downstream JAK/STAT pathway in SKCM. The relationship between the JAK-STAT signaling pathway and melanoma has attracted much research attention. Study had reported that in some melanoma patients, the acquired resistant tumors were related to resistance-associated loss-of-function mutations in the genes encoding interferon-receptor-associated Janus kinase 1 (JAK1) or Janus kinase 2 (JAK2) [35]. In addition, it was shown that melanoma cells lacking TBK1 are primed to undergo RIPK- and caspase-dependent cell death in response to TNF and IFNγ in a JAK-STAT-dependent manner. Moreover, TBK1 inhibition can enhance the response to cancer immunotherapy in melanoma [36]. Similarly, we found that CLSPN knockdown could induce the increase of IFI44L expression and then promote apoptosis by promoting JAK-STAT signaling and activating the downstream molecules of the pathway. Therefore, it also indicated that CLSPN might be nominated as a candidate immune evasion gene like TBK1 and it also acted as a promising target to enhance response to immune checkpoint blockade (ICB) in melanoma. Future studies will be required to further deconvolute the roles of CLSPN in resistance to ICB in SKCM. In addition, the mechanism by which CLSPN deeply regulates IFI44L is still not clear. Future studies will be required to elucidate it.

Meanwhile, our results revealed strong associations between IFI44L and OAS2, as well as MX1. MX1 (MX Dynamin-Like GTPase 1) is a key protein involved in tumor antigen presentation [37–38]. Notably, ulcerated melanoma has been independently linked to moderate or high levels of peri-tumoral MX1 expression, indicating that the tumor microenvironment may undergo alterations in the presence of ulceration [39]. Therefore, these findings indicated again that CLSPN, in addition to being involved in melanoma development through inhibition of IFI44L, may also affect the tumor immune microenvironment (TME) of melanoma. Furthermore, our study identified that CLSPN expression was significant positive associated with the presence of M2 macrophages, while no notable association was observed with M1 macrophages. This suggests that CLSPN may regulate TME by enhancing TAM infiltration and M2 polarization, which in turn promotes tumor progression. TME includes multiple cell types and extracellular matrix and various signal molecules [40]. TAMs, as the most abundant immune cell population within the TME, serve as a major barrier to anti-tumor immunity and contribute to the failure of immunotherapy [41,42,43].

M1 TAMs enhance anti-tumor immune responses and stimulate Th1 immunity, while M2 TAMs suppress immune responses and promote tumor progression [44]. Reprogramming TAMs from the M2 phenotype to the M1 phenotype is considered a promising strategy for cancer treatment [45]. Recently, promoting M1 polarization for tumor suppression and metastasis had been explored in melanoma [46]. Therefore, these results further confirmed that CLSPN was specifically correlated with immune infiltrating cells in SKCM, suggesting that CLSPN may play a crucial role in immune escape in the SKCM microenvironment and regulating the function of TAMs. Elucidating the interaction mechanism between CLSPN and TME could present a novel target for immunotherapy.

Therefore, a comprehensive understanding of immune infiltration in cancer patients is crucial for selecting precise, individualized immunotherapy treatments. We used cMAP to predict drugs that may be effective in melanoma, with the top three being CGP-52,411, TAK-715 and tanespinmycin. CGP-52,411, a tyrosine protein kinase inhibitor targeting the EGF receptor, has been shown to effectively reverse Alzheimer’s disease fibril formation [47]. Meanwhile, TAK-715 may possess anti-tumor and anti-inflammatory regulatory potential as a p38 inhibitor [48–49]. We found CGP-52,411 and TAK-715 significantly inhibited the proliferation and migration of melanoma cell lines and increased apoptosis of tumor cells. Our results indicate the potential role of compounds CGP-52,411 and TAK-715 in melanoma therapy, suggesting the possibility of drug repurposing in precision medicine. Further studies will be conducted in the future.

Conclusion

In this study, we found that CLSPN is a potent promoter of SKCM progression, which is positively associated with poor cancer prognosis. Our experiments showed that CLSPN might lead to tumor proliferation and progression through IFI44L/JAK/STAT1 signaling. In addition, CLSPN was associated with a negative TME in SKCM, leading to the polarization toward the M2 phenotype suppressing the TME and promoting disease progression. Based on our combined findings, CLSPN is highly likely to serve as a biomarker for prognostic. Meanwhile, CLSPN might act as an encouraging target, especially in the growing field of immunotherapy.