OC-STAMP is a potential biomarker and therapeutic target for Silicosis: an exploratory investigation

Abstract

Background

Silicosis, a disease characterized by fibrous changes in lung tissue due to prolonged silica dust inhalation, exhibits a complex pathogenesis that remains inadequately addressed by current interventions. Although osteoclast stimulatory transmembrane protein (OC-STAMP) is implicated in Silicosis progression, its regulatory mechanisms are not fully understood. In this study, we detected elevated OC-STAMP expression in Silicosis patients and found that treatment with OC-STAMP siRNA can alleviate the progression of Silicosis in mice, suggesting the potential of OC-STAMP as a diagnostic and therapeutic target for Silicosis.

Methods

First, rat models of Silicosis were developed at various stages. A suite of histological and molecular techniques, including Hematoxylin and eosin (HE), Masson, Prussian blue staining, and immunohistochemistry, along with real-time polymerase chain reaction (RT-PCR), were employed to assess the expression levels of OC-STAMP, as well as indicators of  ferroptosis and fibrosis.Second, MLE-12 cells were cultured in vitro to establish an OC-STAMP overexpression model, and the relationship between OC-STAMP and ferroptosis was evaluated using flow cytometry, and western blotting. Subsequently, to verify the role of OC-STAMP and ferroptosis in Silicosis progression, we administered OC-STAMP siRNA and Fer-1 to Silicosis mice respectively. Whole-body volumetric plethysmography (WBP) was utilized to assess the respiratory function of the mice, and Micro-CT was applied to detect the lung nodules in the mice. The levels of OC-STAMP, as well as indexes associated with ferroptosis and fibrosis, were assessed using Hematoxylin and eosin (HE), Masson, Sirius red staining, immunohistochemistry, and western blot analysis. The polarization of macrophages towards M1 and M2 phenotypes in lung tissues was analyzed by flow cytometry. Ultimately, the plasma expression of OC-STAMP in patients diagnosed with Silicosis was quantified using enzyme-linked immunosorbent assay (ELISA).

Results

In vivo experiments showed that OC-STAMP accelerates the fibrotic process of Silicosis, which may promote the epithelial-mesenchymal transformation by triggering ferroptosis of alveolar type II epithelial cells, and thus promote the progression of Silicosis. Furthermore, in vitro studies indicated that OC-STAMP overexpression causes ferroptosis in alveolar type II epithelial cells which contributes to fibrosis. Notably, treatment with siRNA in Silicosis mice confirmed that OC-STAMP inhibition effectively mitigates ferroptosis and retarded the progression of Silicosis fibrosis. Plasma of patients with Silicosis exhibited elevated OC-STAMP levels.

Conclusions

Overall, OC-STAMP induces ferroptosis and exacerbates fibrosis in Silicosis. OC-STAMP siRNA and Fer-1 mitigate abnormal collagen deposition and delay the progression of Silicosis. Collectively, these findings highlight the potential of OC-STAMP as a novel biomarker for diagnosing and treating Silicosis.

Introduction

Occupational pneumoconiosis results from the prolonged inhalation of harmful dust and its accumulation in the lungs, with primary pathological changes including the formation of dust nodules and pulmonary fibrosis. Occupational pneumoconiosis is prevalent in China and poses significant health threats to workers. Harmful dust not only affects air quality but also poses a serious risk to human health.

Silicon dioxide (SiO₂) particles are a crucial raw material extensively utilized in the chemical industry, cosmetics, and biomedical fields. silica is also commonly used in the industrial production of glass, ceramics, and cement. However, during these production processes, a large amount of silica dust is released into the air, making it one of the important sources of air pollution. The role of silica in the environment is becoming increasingly complex, as its widespread application has led to environmental concerns. Moreover, silica can also spread through water sources and soil, posing a potential threat to ecosystems. Notably, long-term inhalation of silica dust can lead to lung diseases such as pneumonia and Silicosis. Therefore, the adverse health effects of silica should be better emphasized.

Silicosis, a globally widespread form of pneumoconiosis, results from prolonged exposure to free SiO₂ dust and is characterized by silica nodules and extensive lung tissue fibrosis. Despite extensive research, the etiology of Silicosis remains elusive, with limitations in early detection criteria and a lack of effective treatments [1]. The definitive diagnosis of Silicosis is heavily contingent on factors such as the occupational history of the patient and imaging results. In patients with Silicosis, lung tissue fibrosis is irreversible and continues to progress even after exposure to dusty environments has ceased, thus leading to severe and advanced lesions [2, 3]. Therefore, identifying biomarkers for early Silicosis screening in high-risk populations is critical to achieving substantial economic and social benefits through early intervention [4, 5].

Alveolar type II epithelial cells, also known as alveolar type II cells (AT2) or AEC2, play a crucial role in synthesizing and releasing surfactants. Phenotypic changes in AT2 cells, including pro-fibrotic, apoptotic, senescent, hyperproliferative, and inflammatory transformations, significantly contribute to pulmonary fibrosis [6]. These cells are a primary source of myofibroblasts in Silicosis and are integral to disease progression. Ferroptosis, a form of programmed cell death, is also considered a potential risk factor for Silicosis [7]. In bleomycin-induced fibrosis mouse models, significant collagen and iron deposition is observed in AEC2 and fibrotic tissues. However, ferroptosis inhibitors, such as deferoxamine (DFO), can help halt disease progression by reducing iron deposition in AEC2 and inhibiting ferroptosis [8]. Moreover, intranasal administration of crystalline SiO₂ suspension in mice leads to elevated iron levels in granulomatous tissues by day 56 of exposure. When iron complexes with SiO₂, this interaction can initiate the apoptotic process and disrupt autophagy in granuloma tissue cells. Erastin is a ferroptosis inducer that can induce ferroptosis in cells. Its action leads to iron accumulation and the generation of reactive oxygen species (ROS) in lung epithelial cells, accelerating epithelial–mesenchymal (EMT) transition [9]. Erastin also promotes the differentiation of fibroblasts to myofibroblasts, a process induced by transforming growth factor-β (TGF-β) through ROS stimulation, lipid peroxidation, and suppression of glutathione peroxidase 4 (GPX4). This cascade contributes to collagen accumulation and alveolar structure disruption. Conversely, ferroptosis inhibitors such as ferrostatin-1 (Fer-1) can potentially prevent fibrosis formation. Thus, ferroptosis in AEC2 significantly contributes to fibrosis in Silicosis.

Osteoclast-stimulating transmembrane protein (OC-STAMP), a recently identified fusion molecule, plays a vital role in osteoclast maturation and pathological bone resorption, reducing bone density. OC-STAMP is reportedly upregulated in patients with pneumoconiosis and Silicosis-associated animal models, correlating with reduced bone mineral density and enhanced fibrosis-associated phenotypes. However, the mechanistic pathways associating OC-STAMP expression with fibrotic processes remain unexplored. Therefore, the present study aimed to investigate the relationship between OC-STAMP and fibrosis development in Silicosis using various models and clinical samples.

Materials and methods

Ethical statement

All animal experiments were conducted in compliance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals (NIH Publication No. 8023) and approved by the Ethics Committee of Xiamen Medical College, China. The 3-week-old Wistar rats and C57BL/6 mice, obtained from Shanghai Slacker Laboratory Animal Co., LTD., were raised under specific pathogen-free (SPF) conditions. The animals were individually numbered and then randomly assigned to experimental groups using Excel software.

Establishment and intervention of Silicosis model

Male Wistar rat (3 weeks old, 120 g) and C57BL/6 mouse (16 g–18 g) were purchased from SPF Shanghai Slack Laboratory Animal Co., LTD. (Shanghai, China). The rats were randomly divided into 4 groups: sham, silica exposure for 56 days, silica exposure for 112 days, and silica exposure for 168 days (n = 8, each group). Normal saline containing 50 mg/ml Silica particles (Sigma Aldrich, St. Louis, MO, USA) was injected into the trachea to induce Silicosis model, and 9% normal saline solution was injected into the sham group. The mice were euthanized after 56, 112, and 180 days, respectively. The mice were randomly divided into 6 groups: sham, SiO₂, SiO₂ + Fer-1, Fer-1, SiO₂ + OC-STAMP siRNA, and OC-STAMP siRNA (n = 8 each group). Saline containing 50 mg/kg Silica particles (Sigma Aldrich, St. Louis MO, USA) was injected into the trachea to induce Silicosis. Sham group was injected with 9% normal saline solution. On the second day after molding, SiO₂ + Fer-1 group and Fer-1 group were given 2 mg/kg/d Fer-1 and SiO₂ + OC-STAMP siRNA, respectively. The OC-STAMP siRNA group was intraperitoneally injected with OC-STAMP siRNA 2 mg/kg/d on the second day after modeling, and euthanized 56 days later. The animals were randomly grouped using the following method: on a new Excel (Microsoft, Redmond, WA, USA) worksheet, the rat numbers (ranging from 1 to N) were input in column A (A1:AN). A random number for each rat was generated using the RAND function in column B (B1:BN), with the function yielding a random number in the range of 0 to 1. The A1:BN field was selected, and Excel’s sort functionality was employed. In the Data menu, “Sort” was selected, and in the displayed dialog box, “Sort by column B” was selected, followed by “Ascending.” Once the sorting was completed, a list sorted by random numbers was obtained, allowing animals to be assigned to different groups based on their row numbers. All experimental animal programs have been reviewed and approved by the Medical Ethics Committee of Xiamen Medical College and the Medical Ethics Committee of the Second Affiliated Hospital of Xiamen Medical College, and are in line with the National Institutes of Health’s “Guidelines for the Care and Use of Experimental Animals.

FinePoint whole-body plethysmography (WBP) non-invasive dynamic monitoring of mouse respiratory function

Before testing, it was confirmed that the two tracing chambers were closed and properly connected to the host. The two cavities were calibrated individually, and “WPB Volume” was selected as the parameter setting. The mice were then placed into the test room in advance, allowing them to adapt for 30 min. The indoor environment was kept quiet, with efforts to reduce the entry of irrelevant personnel and other disturbances. For detection, two mice were placed into the plethysmography chamber, named respectively, and detected. The system displayed real-time changes in the respiratory rate and waveform of the mice. The system automatically detected the data and recorded the indicators of lung function. For data export, following the completion of the detection, the experiment was ended, and all experimental results were selected and exported in the form of Excel data sheets and chart reports. The main pulmonary function indicators include tidal volume (Tvb), respiratory rate (F), minute volume (Mvb), inspiratory time (Ti), peak inspiratory flow (PIF), expiratory time (Te), peak expiratory flow (PEF), mid expiratory flow rate (EF50), and enhanced respiratory interval (airway stenosis index, en). Enhanced pause (Penh) and pause (PAU). According to the meanings of each indicator, they are roughly divided into ventilation function indicators (including Tvb, F, and Mvb), restrictive ventilation dysfunction related indicators (including Ti and PIF), and obstructive ventilation dysfunction related indicators (including EF50, Penh, and PAU).

Histopathology

The rat lungs were fixed in 4% paraformaldehyde and embedded in paraffin. Then, the sections were stained with hematoxylin and eosin (H&E), Masson trichrome, and hematoxylin and eosin (H&E) stained with cresyl violet to evaluate the modeling of the tissue. Prussian blue staining was used to detect iron ion deposition. The slides were scanned using a panoramic scanning electron microscope. The H&E staining was analyzed using the Ashcroft scoring method [10]. Image J was used to analyze the Masson and hematoxylin and eosin (H&E) staining results.

Quantitative real-time PCR

According to the manufacturer’s protocol, an ultrapure RNA kit (Abclonal, WuHan, China) was used to extract total RNA from tissues. Complementary DNA was synthesized by cDNA synthesis system. In the Real-Time PCR assay system, cDNA amplification was performed by QuantiFast SYBR Green PCR Kit (Abclonal, WuHan, China). GAPDH was used as the internal reference gene. Comparative Ct (2−ΔΔCt) was used to analyze the data. The comparative Ct method (2−ΔΔCt) was used to analyze data. The sequences of primers for qPCR are as follows: Rat GAPDH Forward: ACGGCAAGTTCAACGGCACAG, Reverse: CGACATACTCAGCACCAGCATCAC. Rat OC-STAMP Forward: ACTTCTCTGGCCTGGAGTTCCTG, Reverse: AAGCGTAGGTCGGTGAGGTAGC. Rat E-Cadherin Forward: CACCAGATGACGATACCCGG, Reverse: ACTTCCGGTCTGGCATCAAG. Rat N-Cadherin Forward: GGGAATCAGACGGCTAGACG, Reverse: TCAGCAGCTTTAAGGCCCTC. Rat Collagen I Forward: CCAGCCGCAAAGAGTCTACA, Reverse: AGGCCATTGTGTATGCAGCT. Rat fibronectin Forward: GGCCACTTCCGAATCTGTCA, Reverse: GCTCATCTCCTTCCTCGCTC. Rat NF-KB Forward: AGCTCATGCCCAACTTCTCC, Reverse: AGGACTTCCGGTACTCCCTC. Rat LCN2 Forward: CTGATGGTTCAGGTCCCACC, Reverse: TGGATGGGGAGAGCTGATCA. Rat GPX4 Forward: CTCCATGCACGAATTCGCAG, Reverse: GGCATGCAGATCGACTAGCT. Mouse GAPDH Forward: GGCAAATTCAACGGCACAGTCAA, Reverse: TCGCTCCTGGAAGATGGTGATGG. Mouse OC-STAMP Forward: CGGAACACCTCTTTGGCTTGGG, Reverse: TGAGCACAAATAGGCAGCGGATG.

M1/M2 macrophage polarization was detected by flow cytometry

The lung tissue was ground to obtain single cells, and the antibodies CD86+, MHC-II, CD206+ were incubated for 1 h according to the instructions, and the mean fluorescence of the cells was detected by flow cytometry.

Cell culture and treatment

The MLE-12 cell line was derived from Shanghai Fuheng Cell Bank, China. In the experiments, non-mycoplasma cells were used, and all media contained 10% fetal bovine serum (BISH1475, Biological Industries) and antibiotics (penicillin and streptomycin, Life Technologies/Gibco, Gaithersburg, MD). All cells were cultured at 37 °C and 5%CO₂. The OC-STAMP overexpression model of MLE-12 cells was established: MLE-12 cells were placed in a culture dish of 6 cm², OC-STAMP plasmid (MR207985, OriGene) was transfected with lipo3000 (L3000015, Thermo Fisher), and the establishment of OC-STAMP overexpression model was detected by western blot 72 h after transfection. To determine ferroptosis induced by OC-STAMP overexpression, rescue experiments were performed. Animals were divided into four groups: sham group, OC-STAMP, Fer-1, and OC-STAMP + Fer-1. OC-STAMP plasmid was transfected into MLE-12 cells using Lipo3000 (L3000015, Thermo Fisher Scientific). After 24 h, the OC-STAMP overexpression and Fer-1 groups were treated with 2 μM Fer-1 (17729, Cayman). After another 48 h, western blotting was performed to detect the expression of related proteins in each group.

Immunohistochemical staining

Tissue sections were dewaxed to water, antigenic repair was performed with citrate buffer, washed with PBS, and sealed at room temperature with 10%BSA for 1 h. Then, monoclonal OC-STAMP (1/100 dilution, 2051, PB1; FabGennix Co., LTD., Frisco, Texas, USA), E-cadherin (E-cad, 1:1000 dilution, GB11082-100, Servicebio, China), LCN2 (1:1000 dilution, DF6816, Affinity, (China), NF-KB (1:1000 dilution, RA1102, China report), overnight staining at 4 °C. After sample washing, incubated with matched secondary antibodies for 1 h. It is then stained with DAB (Beyotime) and finally stained with hematoxylin (Beyotime). For each sample, 5 pictures of different parts were randomly selected under a microscope (20×) field of view and scored. According to the results of Immunohistochemical staining, Immunohistochemical scoring method was used to score the staining intensity from 0 to 3 points (0 points, negative staining; 1 point, light yellow; 2 marks, light brown; 3 points, dark brown), and the staining area was scored 1–4 points (1 point, area 0% −26%; 2 min, area 26% −51%; 3 min, area 5 1% −76%; 4 points, area 76%–100%), the product of staining intensity and staining area was the positive grade of the comprehensive score (negative: 0; Weak positive: 1–4 points; Positive: 5–8 points; Strong positive: 9–12 points) [11].

Western blot analysis

The obtained cell or tissue Protein sample was then quantified by BCA Protein Assay Kit (MA0082, Meilunbio), then SDS was added and the sample was denatured by boiling for 10 min. The sample is then separated by size using 8 to 15 percent sds-page (SDS–Polyacrylamide gel electrophoresis). The transfer time was determined based on the size of the target protein, and then the protein of interest was transferred to the PVDF membrane. The PVDF membrane was sealed with 5% buttermilk or bovine serum albumin at room temperature for 1 h. The PVDF membrane was cleaned three times with TBST, and the corresponding primary antibody OC-STAMP (1/100 dilution, 2051,PB1; FabGennix Inc., Frisco, TX, USA), E-cadherin (E-cad, 1:1000 dilution, GB11082-100, Servicebio, China), N-cadherin (N-cad, 1:1000 dilution, GB12135-100, Servicebio, China), LCN2 (1:1000 dilution, DF6816, Affinity, China), NF-KB (1:1000 dilution, RA1102, Report, China), LCN2 (1:1000 dilution, DF6816, Affinity, China), α-SMA (1:1000 dilution, Abclone, China), Vimentin (1:1000 dilution, BF8006, Affinity, China), GPX4 (1:1000 dilution, A21440, Abclone, China), SLC7A11 (1:100 dilution, GB115276-100, Servicebio, China). The primary antibody was incubated overnight, and the PVDF membrane was cleaned three times with TBST, and the secondary antibody HRP-conjugated Goat anti-Mouse IgG (H+L) (AS003, Abclonal, China), HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014, Abclonal, China) was incubated for 1 h, and the PVDF membrane was cleaned three times with TBST. ECL Enhanced Plus Kit (RM00021P, Abclonal, China) developer was incubated for development, and Image J was used to measure the gray values of target protein and internal reference protein.

Enzyme-linked ImmunoSorbent assay

We enrolled a total of 12 subjects from January 2021 to February 2024, including 6 healthy controls from the Health Examination Center of the Second Affiliated Hospital of Xiamen Medical College and 6 pneumoconiosis patients. All pneumoconiosis patients were diagnosed in accordance with the “Chinese National Diagnostic Criteria for Pneumoconiosis” (GBZ70-2015), consistent with the classification of pneumoconiosis by the International Labor Organization (ILO) in 1980. All enrolled patients completed chest CT, X-ray, and corresponding physical examination. The observation group consisted of Silicosis patients exposed to dust, while the Sham group included healthy males with no history of coal dust exposure aged 40 and above. Inclusion criteria required a long-term dust exposure history, dust exposure time exceeding 1 year (“dust exposure time”), and no occupational protection measures during work. Exclusion criteria encompassed neuropsychiatric diseases, chronic liver and kidney function impairment, as well as cardiovascular and cerebrovascular diseases. This study was approved by Institutional Ethics Committee (2024010) and obtained written informed consent from all subjects in accordance with the Helsinki declaration. The plasma of Silicosis patients and healthy people was collected, and the expression level of OC-STAMP was detected according to the instructions of the manufacturer of Human OCSTAMP ELISA Kit (Animalunion Biotechnology, Shanghai, China).

Statistical analysis

Data are expressed as mean ± standard deviation, and P-values < 0.05 were considered statistically significant, within a 95% confidence interval. The t-test was used for statistical analysis between the two groups, while one-way analysis of variance (ANOVA) and Tukey’s multiple comparison tests were used for comparison between more than two groups. The groups were compared using GraphPad Prism (version 8) software (GraphPad Software Inc., San Diego, CA, USA).

Results

OC-STAMP, ferroptosis, and fibrosis-related indexes were activated in the Silicosis fibrosis process

After establishing a Silicosis mouse model, the experimental results (Fig. 1A) indicated that rats in the Sham group maintained glossy fur, smooth breathing, responsiveness to surroundings, regular intake of food and water, and stable mental states. In contrast, rats in the SiO₂ modeling group exhibited dull and disorganized fur, significantly reduced activity, varying degrees of depression, decreased food and water intake, and shortness of breath. HE staining revealed pathological changes at various stages in the Silicosis group. These changes included the formation of cellular nodules due to macrophage and neutrophil aggregation on day 56, progression to cellular-fibrous nodules with a small number of collagen fibers in the center by day 112, and further progression to fibrous nodules covered with a large number of collagen fibers and fewer cells by day 168 (Fig. 1B). Masson staining, which stains the collagen fibers blue, helped confirm an increase in collagen fibers over time in the Silicosis group (Fig. 1B, C). Immunohistochemical analysis indicated that the expression level of vimentin in the SiO₂ group was significantly increased at different periods (Fig. 1B, D).

Fig. 1

SiO₂ induce Silicosis. A Timeline of treatment with Silica particles (50 mg/ml) or 1 ml of sterile saline (Sham). Rats were executed on days 56, 112, and 168, respectively. B HE staining of lung tissues of rats in silica modelling group and Sham group at different periods (n = 5). B, C Masson staining and collagen content of lung tissue from rats in Silica moulding group and Sham at different periods (n = 5). B, D Immunohistochemical staining of Vimentin in lung tissues of rats in different periods in Sham group and Silicone model group (n = 5). All data were expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

To determine whether Silicosis fibrosis occurs through the ferroptosis pathway, we evaluated the expression of relevant ferroptosis indicators. Prussian blue staining revealed increased iron accumulation in lung tissues of all silica-exposed groups at various time points of SiO₂ exposure (Fig. 2A). Immunohistochemical analysis indicated that OC-STAMP expression significantly increased (Fig. 2A, B), whereas GPX4 expression significantly decreased during different periods of SiO₂ exposure (Fig. 2A, C).

Fig. 2

Ferroptosis is abnormally activated in Silicosis at different periods. A Prussian blue staining of rat lung tissue in silica moulding group and Sham group at different periods (n = 5). A, B Immunohistochemical staining of OC-STAMP in lung tissues of rats in different periods in Sham group and silicosis model group (n = 5). A, C Immunohistochemical staining of GPX4 in lung tissues of rats in different periods in Sham group and silicosis model group (n = 5). All data were expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Further, using real-time fluorescence quantitative PCR, we detected the mRNA expression of genes related to ferroptosis, fibrosis, and other related indicators in lung tissues of rats exposed to silica dust for 168 d. We observed that the mRNA expression levels of the E-cadherin (Fig. 3A) and GPX4 (Fig. 3B) genes were significantly downregulated, whereas those of OC-STAMP (Fig. 3C), Nf-KB, (Fig. 3D), lipocalin 2 (LCN2) (Fig. 3E), N-cadherin (Fig. 3F), collagen I (Fig. 3G), and fibronectin genes (Fig. 3H) were significantly upregulated. Collectively, these results suggest that increased OC-STAMP expression is associated with activation of ferroptosis, EMT, and fibrosis-related pathways during the development of Silicosis. Finally, we detected the expression level of OC-STAMP in the plasma of healthy individuals and patients with Silicosis using ELISA to verify the expression of OC-STAMP in clinical samples. Our results revealed that patients exhibited significantly higher OC-STAMP levels than healthy individuals (Fig. 3I).

Fig. 3

OC-STAMP, Ferroptosis and fibrosis-related signals are abnormally activated in Silicosis. A–H Real-time fluorescence quantitative PCR to detect the mRNA expression levels of E-cadherin, GPX4, OC-STAMP, NF-KB, LCN2, N-cadherin, Collagen I, and Fibronectin in the lung tissues of rats in the silica 168d group and the control group (n = 3). I ELISA for OC-STAMP expression in plasma of healthy individuals and Silicosis patients (n = 12). All data were expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

OC-STAMP overexpression induces ferroptosis in fibrosis

To examine the role of OC-STAMP in fibrosis mediated via ferroptosis, we performed rescue experiments by establishing a MLE-12 cell model overexpressing OC-STAMP and administering a ferroptosis inhibitor (Fig. 4A). Flow cytometry analysis revealed that OC-STAMP overexpression increased intracellular ROS levels, which were reduced by the ferroptosis inhibitor (Fig. 4B, C). Scratch assay findings demonstrated that OC-STAMP overexpression enhanced cell migration, and this effect was mitigated by the ferroptosis inhibitor (Fig. 4D, E). Moreover, immunoblotting indicated that OC-STAMP overexpression decreased the protein expression levels of SLC7A11 and GPX4 and increased those of α-SMA and vimentin. Notably, the ferroptosis inhibitor restored the ferroptosis phenotype induced by OC-STAMP overexpression and alleviated the fibrosis phenotype, as evidenced by the modulation of α-SMA and vimentin levels (Fig. 4F–K).

Fig. 4

OC-STAMP induces Ferroptosis in MLE-12 cells and promotes fibrosis. A Establishment and intervention of OC-STAMP overexpression cell model. B, C Flow cytometry detection of overexpression of OC-STAMP and Fer-1 interfering with reactive oxygen species expression (n = 3). D, E Scratch assay to detect overexpression of OC-STAMP and Fer-1 interfering with MLE-12 cell migration (n = 3). F–K Immunoblotting to detect overexpression of OC-STAMP and Fer-1 intervening in the expression levels of OC-STAMP, Vimentin, α-SMA, GPX4, SLC7A11 proteins in MLE-12 cells (n = 3). All data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Ferroptosis inhibition improves respiratory function in Silicosis mice

To determine whether inhibiting ferroptosis would delay Silicosis fibrosis in mice, we established a mouse Silicosis model and administered Fer-1 (Fig. 5A). Using a FinePointe whole-body volumetric measurement system, we noninvasively monitored lung function changes in conscious mice following SiO₂ infusion and treatment with Fer-1. Disrupted ventilation, restrictive ventilatory dysfunction, and increased small airway resistance were evident, leading to changes in F, Penh, and reductions in Tvb, Mvb, Ti, PIF, PAU, and EF50. Notably, treatment with Fer-1 improved these respiratory function parameters (Fig. 5B–I).

Fig. 5

Ferroptosis inhibitors improve respiratory function in SiO₂-damaged mice. A Timeline of silica particles (50 mg/kg), Ferroptosis inhibitor intervention, and 50 µl sterile saline (Sham) treatment. B, I FinePointe whole-body volumetric tracing test system for Tvb, F, Mvb, Ti, PIF, Te, PEF, EF50, Penh, PAU respiration-related indices (n = 3). All data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Ferroptosis inhibitors delay the progression of Silicosis fibrosis in mice

Micro-CT in mice demonstrated high-density shadows predominantly in the airways and peribronchioles of the SiO₂ group. In contrast, the shadows in the lung lobes of the group treated with the ferroptosis inhibitor were fewer and smaller (Fig. 6A). HE staining revealed that the lung tissues of mice in the Sham group were structurally intact and clear, with thin alveolar septa and no inflammatory cell infiltration. Conversely, the lung tissues of the SiO₂ group exhibited pronounced inflammatory cell reactions, with macrophages, lymphocytes, and neutrophils aggregating around the bronchioles and blood vessels. The alveolar septa were thickened, and cellular nodules comprising scattered macrophages and a few fibroblasts appeared. In the group treated with the ferroptosis inhibitor, inflammatory cell infiltration in the alveolar septa, thickening of alveolar septa, and a few silica nodules were observed. The Ashcroft score increased in both the SiO₂ and ferroptosis inhibitor groups (Fig. 6B). Masson’s trichrome staining indicated an increase in collagen fibers in the SiO₂ group and a decrease in collagen fibers in the ferroptosis inhibitor group (Fig. 6C). Sirius red staining revealed collagen fiber deposition in the interior and margins of the nodules as well as in the lung interstitium in the SiO₂ group. Notably, this deposition was reduced in the ferroptosis inhibitor group (Fig. 6D), consistent with the Masson staining results. Lung weight coefficient measurements indicated an increase in the SiO₂ group and a decrease in the ferroptosis inhibitor group (Fig. 6E).

Fig. 6

Inhibition of Ferroptosis signalling in mice lung tissue effectively restores silica particles-induced pulmonary fibrosis. A–D Changes in lung histomorphology were assessed by Micro-CT, HE staining, Masson staining, and Sirius staining in silica modelling group, Ferroptosis inhibitor intervention group, and Sham rats (n = 3). E Lung weight coefficients of rat lung tissue in silica modelling group, Ferroptosis inhibitor intervention group and Sham group (n = 3). All data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Western blotting revealed no differences in the expression levels of E-cadherin, N-cadherin, vimentin, α-SMA, NF-κB, LCN2, SLC7A11, and GPX4 between the Sham and Fer-1 groups. The expression levels of E-cadherin and GPX4 in the SiO₂ group were downregulated whereas those of N-cadherin, vimentin, α-SMA, NF-κB, and LCN2 were upregulated, and the opposite trend was observed in the SiO₂ group treated with the ferroptosis inhibitor (Fig. 7A–I).

Fig. 7

Inhibition of Ferroptosis signalling in mouse lung tissue effectively restores silica particles-induced pulmonary fibrosis. A–I Protein expression levels of E-cadherin, N-cadherin, NF-KB, LCN2, Vimentin, α-SMA, SLC7A11, and GPX4 in mouse lung tissues were detected by Immunoblotting (n = 3). All data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

OC-STAMP siRNA improves respiratory function in Silicosis mice

To determine whether OC-STAMP siRNA inhibits the pathological progression of Silicosis fibrosis in mice, we established a mouse model of Silicosis (Fig. 8A). Using a FinePointe whole-body volumetric tracing detection system, we noninvasively monitored respiratory function changes in conscious mice following SiO₂ infusion and treatment with Si-OC. Mice infused with SiO₂ exhibited elevated F, Penh, and PAU and decreased Tvb, Mvb, Ti, and PIF, indicating a shallow and rapid respiratory pattern compared to that in mice in the sham group. Conversely, the Si-OC intervention group demonstrated improved lung function, as evidenced by decreased F, Penh, and PAU and increased Tvb, Mvb, Ti, and PIF (Fig. 8B–I).

Fig. 8

OC-STAMP siRNA improve respiratory function in SiO₂-damaged mice. A Timeline of silica particles (50 mg/kg), OC-STAMP siRNA intervention, and 50 µl sterile saline (Sham) treatment. B, I FinePointe whole-body volumetric tracing test system for Tvb, F, Mvb, Ti, PIF, Te, PEF, EF50, Penh, PAU respiration-related indices (n = 3). All data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

OC-STAMP siRNA delays the progression of Silicosis fibrosis in mice

Micro-CT revealed that compared to the lungs of mice in the Sham group, those in mice in the SiO₂ group displayed prominent high-density shadows around the trachea and bronchioles. In contrast, the lungs in the Si-OC intervention group exhibited fewer and smaller shadows (Fig. 9A). Pathological examination using HE, Masson, and Sirius red staining indicated reduced fibrosis in the Si-OC intervention group (Fig. 9A–D). Lung weight coefficient measurements indicated an increase in the SiO₂ group and a decrease in the OC-STAMP siRNA intervention group (Fig. 9E).

Fig. 9

OC-STAMP siRNA delayed the progression of Silicosis. A–D Changes in lung histomorphology were assessed by Micro-CT, HE staining, Masson staining, and Sirius staining in Silica modelling group, OC-STAMP siRNA group, OC-STAMP siRNA intervention group, and Sham rats (n = 3). E Lung weight coefficients of rat lung tissue in Silica modelling group, OC-STAMP siRNA group, OC-STAMP siRNA intervention group and Sham group (n = 3). All data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Inhibition of ferroptosis by OC-STAMP siRNA delays the progression of Silicosis fibrosis in mice

Immunohistochemical staining indicated elevated OC-STAMP expression in the SiO₂ group, predominantly within silicon nodules, compared to that in the Sham group. Similarly, the expression levels of NF-κB and LCN2 were upregulated, whereas that of E-cadherin was downregulated. However, the Si-OC intervention resulted in decreased OC-STAMP, NF-κB, and LCN2 expression and increased E-cadherin expression, thereby mitigating the fibrotic effects induced by SiO₂ (Fig. 10A–E).

Fig. 10

OC-STAMP siRNA could inhibit the expression of ferroptosis and epithelial–mesenchymal transition. A, B Immunohistochemical detection of protein expression levels of OC-STAMP in mouse lung tissue (n = 3). A–C Immunohistochemical detection of protein expression levels of NF-KB in mouse lung tissue (n = 3). A–D Immunohistochemical detection of protein expression levels of LCN2 in mouse lung tissue (n = 3). A–E Immunohistochemical detection of protein expression levels of E-Cadherin in mouse lung tissue (n = 3). All data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Intratracheal instillation of SiO₂ and administration of OC-STAMP siRNA altered the macrophage dynamics in mouse lung tissue, affecting the M1/M2 cell ratio. In the SiO₂ group, we observed a decrease in the proportion of interstitial macrophages (IMs) (Fig. 11A–D), an increase in CD86⁺ and MHC-II⁺ alveolar macrophages (AMs) (Fig. 11E–H), and a decrease in CD206⁺ cells (Fig. 11I, J). Additionally, CD86⁺ IMs increased (Fig. 11K, L) while MHC-II⁺ and CD206⁺ IMs decreased (Fig. 11M–P). The Si-OC intervention reversed these changes, enhancing M1 polarization levels.

Fig. 11

Inhibition of OC-STAMP in mouse lung tissue inhibits M1-type giant filament cell polarisation and enhances M2 polarisation. A–D Flow cytometry detection of alveolar macrophages, interstitial macrophages in rat lung tissues from silica modelling group, OC-STAMP siRNA intervention group and control group (n = 3). E, F Proportion of CD86+ positive cells in alveolar macrophages (n = 3). G, H Proportion of MHC-II+ positive cells in alveolar macrophages (n = 3). I, J Proportion of CD206+ positive cells in alveolar macrophages (n = 3). K, L Proportion of CD86+ positive cells in interstitial lung macrophages (n = 3). M, N Proportion of MHC-II+ positive cells in interstitial lung macrophages (n = 3). O, P Proportion of CD206+ positive cells in interstitial lung macrophages (n = 3). All data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Immunoblotting assays revealed that in the SiO₂ group, OC-STAMP, NF-κB, and LCN2 protein levels were upregulated, whereas that of SLC7A11 and GPX4 were downregulated, alongside downregulation of EMT and fibrosis factor E-cadherin. Conversely, N-cadherin, vimentin, and α-SMA levels were upregulated. The Si-OC intervention altered these protein expression levels and ameliorated lung fibrosis (Fig. 12A–J).

Fig. 12

Inhibition of OC-STAMP in mouse lung tissue inhibits Ferroptosis to improve fibrosis. A–J Protein expression levels of OC-STAMP, E-cadherin, N-cadherin, NF-KB, LCN2, Vimentin, α-SMA, SLC7A11and GPX4 in mouse lung tissues were detected by immunoblotting (n = 3). All data are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001

Discussion

In the present study, we employed tracheal perfusion to develop Silicosis models at various time points. We used light microscopy and transmission electron microscopy to observe lung tissue morphology and pathological changes across groups. HE staining revealed the accumulation and formation of nodules by macrophages and neutrophils on day 56 of Silicosis, progressing to cellular-fibrous nodules by day 112, with a small number of collagen fibers deposited at the nodule centers. On day 168, the nodules had evolved into a fibrous stage, densely packed with collagen fibers and fewer cells. Further, to enhance the visualization of collagen fibers, we used the Masson staining technique to dye the collagen fibers blue. The results indicated a gradual increase in collagen fibers in all experimental groups, with emphysema and alveolitis observed in the experimental animal group, whereas no significant changes occurred in the Sham group. The immunohistochemical results of vimentin in each silica-exposed group at different periods were consistent with those of the Masson staining results. Overall, these findings confirm the successful establishment of a rat Silicosis model that mimics the progression of this disease.

Silicosis, an occupational lung disease caused by crystalline silica exposure, lacks early diagnostic tools. OC-STAMP is a protein transmembrane protein that plays an important role in bone absorption and cell fusion, and recent studies have revealed that OC-STAMP not only plays a role in bone metabolism but is also involved in the pathogenesis of Silicosis [12]. We hypothesized that OC-STAMP could provide more reliable specificity in diagnosing Silicosis compared to inflammatory cytokines markers such as TNF-α, IL-1, IL-6, and IL-17, which also exhibit significant variation in other lung diseases. For example, TNF-α, IL-1β, and IL-6 levels are elevated in the serum of patients with chronic obstructive pulmonary disease (COPD) and correlate with disease severity [13]. Moreover, IL-17 expression is implicated in the progression of chronic lung diseases such as COPD, lung cancer, cystic fibrosis, and asthma [14]. Therefore, before using these inflammatory factors to evaluate Silicosis, it is crucial to exclude the aforementioned diseases. Other potential markers, including KL-6, SP-D, and CC16, are also not highly specific for diagnosing Silicosis. For example, serum KL-6 and SP-D are potential biomarkers for monitoring and predicting disease activity in interstitial lung disease associated with systemic sclerosis and mixed connective tissue disease [15]. Similarly, CC16 may serve as a potential biomarker for various lung diseases, such as acute lung injury, bronchopulmonary dysplasia, and COPD [16]. Notably, OC-STAMP expression has not been reported in other inflammatory and fibrotic lung diseases, nor in liver and bone fibrosis. Given that OC-STAMP mediates osteoclast differentiation and fusion [12], we speculate that it is likely not prevalent in general inflammatory and fibrotic diseases. Current research suggests that the causes of elevated OC-STAMP levels may be linked to two specific types of diseases. First, elevated OC-STAMP levels may be linked to lung diseases caused by the accumulation of particulate matter. Osteoclast transformation of pulmonary macrophages is observed in patients with Silicosis or alveolar microlithiasis as well as in corresponding experimental model mice [17, 18]; however, this phenomenon has not been reported in other lung fibrotic diseases. Second, its upregulation is linked to granuloma-like inflammatory diseases, as osteopontin (OPN) is upregulated exclusively in tissues affected by Silicosis and tuberculosis [19]. Both OPN and OC-STAMP play roles in bone metabolism, suggesting that OC-STAMP may exhibit properties similar to those of OPN in the context of tuberculosis and Silicosis. Overall, our results suggest that OC-STAMP is likely highly specific for diagnosing Silicosis and may only be relevant to pulmonary diseases associated with particulate deposition and granulomatous conditions. Nonetheless, it is crucial to conduct further research to confirm these findings. At present, the treatment of Silicosis primarily focuses on relieving symptoms and delaying disease progression, as there is no effective treatment to reverse pulmonary fibrosis. This also limits the usefulness of biomarkers in treatment.

OC-STAMP may play a role in Silicosis by promoting the senescence of alveolar type II epithelial cells. In a Silicosis rat model, the expression level of OC-STAMP is increased, and the overexpression of OC-STAMP can promote EMT, endoplasmic reticulum stress, and cell senescence [20], thus aggravating Silicosis fibrosis. N-acetyl-sericyl-aspartyl-lysyl-proline can inhibit RANKL signaling by inhibiting OC-STAMP expression, alleviating the symptoms of Silicosis fibrosis [21]. Overall, OC-STAMP may serve as a potential target for Silicosis therapy and could help alleviate pulmonary fibrosis in patients by inhibiting OC-STAMP expression or its downstream signaling pathway. In the present study, Silicosis rats exhibited increased levels of OC-STAMP and proteins related to the RANKL pathway, including AP-1, NFATc1, and NF-κB. This was confirmed in AMs, which, similar to osteoclasts, belong to the monocyte lineage. In addition, recombinant RANKL from mice can induce osteoclast differentiation in RAW 264.7 cells [18]. In our study, lung tissues from rats in the Silicosis 168 d group exhibited increased OC-STAMP expression and NF-κB activation, consistent with previously reported findings. Notably, OC-STAMP expression was significantly increased, primarily within AT2 epithelial cells, and its overexpression activated NF-κB, suggesting a robust association with Silicosis.

Numerous studies have established a strong relationship between ferroptosis and pulmonary fibrosis. Substantial iron accumulation in lung tissue from patients with idiopathic pulmonary fibrosis, as well as in experimental models of bleomycin-induced pulmonary fibrosis, correlates with pulmonary function decline. The ferroptosis inducer erastin promotes EMT in a mouse lung epithelial cell line, alongside ROS generation and upregulation of heme oxygenase-1 expression [22]. During the development of Silicosis, ferroptosis is observed in macrophages, triggering the release of pro-fibrotic cytokines and promoting fibrosis [23]. Notably, dihydroquercetin significantly inhibits ferroptosis in human bronchial epithelial cells and reduces the expression of fibrotic marker expression in human fetal lung fibroblasts MRC-5 [24]. Ferroptosis, an iron-dependent programmed cell death distinct from apoptosis and necrosis, involves glutathione (GSH) depletion, lipid peroxidation, and divalent iron ion deposition. Ferritin synthesis, predominantly occurring on cell membrane surfaces, plays a role in various physiological and pathological processes. Intracellular iron levels are regulated through uptake, storage, release, and metabolism, maintaining iron homeostasis by scavenging free radicals, regulating energy, and responding to oxidative stress. Among several key genes, LCN2 regulates intracellular Fe²⁺ content through its ferric ion-chelating function [25]. In our study, we observed significant upregulation of Fe²⁺ and LCN2 expression in the lung tissues of rats in the silica 168 d group, which enhanced their susceptibility to ferroptosis. Activation of the NF-κB pathway plays a pivotal role in promoting LCN2 transcription, with increased NF-κB expression suggesting potential activation of LCN2 and thereby accelerating ferroptosis [26]. SLC7A11 and GPX4 serve as crucial antioxidant defenses against ferroptosis. Specifically, SLC7A11, which is integral to cystine/glutamate transport, facilitates cystine uptake, essential for GSH synthesis. GPX4 utilizes GSH to reduce lipid ROS, thereby inhibiting ferroptosis [27]. This study observed ferroptosis signaling activation at various stages of Silicosis exposure in a rat model, with iron deposition observable in lung tissues via Prussian blue staining. Immunohistochemical results indicated decreased GPX4 expression in animal groups exposed to silica for different periods. Real-time quantitative PCR indicated reduced mRNA levels of the genes GPX4 and E-cadherin in silica 168 d rats, whereas the mRNA levels of N-cadherin, collagen I, and fibronectin genes were significantly increased. These changes are indicative of EMT and the emergence of a fibrotic phenotype. Overall, these findings suggest a link between ferroptosis activation and fibrosis development.

Ferroptosis may serve as a novel marker for assessing lung function changes; however, specific markers remain elusive. In our models, high OC-STAMP expression was accompanied by ferroptosis and EMT signaling activation. We postulate that OC-STAMP may promote EMT by inducing ferroptosis, thereby accelerating Silicosis fibrosis. Ferroptosis in alveolar epithelial cells accelerates pulmonary fibrosis, with increases in ROS and Fe²⁺ following bleomycin or lipopolysaccharide exposure. Both Fer-1 and DFO effectively mitigate Fe²⁺ accumulation and cell death, offering insights into the mechanisms of lung fibrosis driven by ferroptosis [28, 29].

Based on previous studies, this study established in vitro cell models with overexpression or inhibition of OC-STAMP. We observed that OC-STAMP expression was negatively correlated with GPX4 and SLC7A11 expression, indicating a potential role in ferroptosis induction. To investigate whether OC-STAMP triggers fibrosis through iron overexpression, this study conducted a series of rescue experiments. Specifically, we investigated whether the ferroptosis pathway could inhibit fibrosis induced by OC-STAMP overexpression and found that this overexpression contributed to EMT, aligning with previous findings [20]. Moreover, when the ROS levels increased, Fer-1 inhibited the EMT induced by OC-STAMP overexpression, thus decreasing ROS levels. Moreover,  OC-STAMP overexpression activated NK-KB and LCN2 and induced dysregulation of iron homeostasis in cells, thus aggravating the production of ROS. The overexpression of OC-STAMP led to ferroptosis and fibrosis, whereas Fer-1 mitigated OC-STAMP overexpression, thus inducing ferroptosis and fibrosis. These findings suggest that OC-STAMP overexpression can trigger ferroptosis and accelerate the fibrotic process. Notably, the ferroptosis inhibitor inhibited the expression of OC-STAMP. While we initially aimed to demonstrate that OC-STAMP is one of the regulators of ferroptosis, we also found that the ferroptosis inhibitor can suppress the expression of OC-STAMP. Therefore, we propose that the regulation of biological organisms is not a one-way linear regulation; rather, key molecules function as nodes within a complex network. Signals from upstream factors can influence downstream processes and, in turn, may be transmitted back upstream along the pathway, forming a feedback loop. This phenomenon is likely due to the anti-inflammatory effects of ferroptosis inhibitors, which target OC-STAMP through the inflammation-related RANKL pathway [30, 31], consequently decreasing the expression of OC-STAMP. These findings suggest that OC-STAMP overexpression can trigger ferroptosis and accelerate the fibrotic process.

Subsequently, this study established a mouse model of Silicosis and performed therapeutic interventions using ferroptosis inhibitors. The results revealed that Fer-1 effectively ameliorated SiO₂-induced lung ventilation impairments, including both restrictive and obstructive ventilation disorders. Administration of Fer-1 reduced lung weight, improved lung histopathology, and optimized collagen deposition in Silicosis mouse models. Fer-1 suppressed epithelial mortality and mesenchymal transition, contributing to the alleviation of pulmonary fibrosis symptoms in these models, as confirmed using immunoblotting, consistent with previous findings [9, 29, 32]. Overall, OC-STAMP siRNA mitigated SiO₂-induced ferroptosis and fibrosis in lung tissues of the Silicosis mouse model. Lung function assessment was demonstrated to be an effective tool for categorizing indices related to ventilatory function (F, Tvb, Mvb), restrictive ventilatory dysfunction (Ti, PIF), and obstructive ventilatory dysfunction (Penh, EF50, PAU). The mouse Silicosis lung model demonstrated impairment in various respiratory function parameters, with Tvb and Mvb reflecting overall respiratory system function and respiratory reserve capacity [33]. A decrease in Tvb led to inadequate lung ventilation in mice with Silicosis fibrosis, thus requiring an increased respiratory rate to maintain adequate ventilation. On day 56 post-SiO₂ injection, shallow and rapid respiration consistent with restrictive ventilatory dysfunction was observed, accompanied by decreased Ti and PIF levels. Elevated Penh and PAU levels suggest enhanced constrictive capacity of the small airways, resulting in increased resistance. These findings align with previous findings demonstrating that OC-STAMP siRNA improves SiO₂-impaired ventilatory function as well as restrictive and obstructive ventilatory dysfunction, effectively ameliorating the progression of Silicosis fibrosis.

Osteoclasts, which are part of the hematopoietic monocyte–macrophage system, arise from macrophages. These macrophages can differentiate into pro-inflammatory M1 macrophages and anti-inflammatory M2 macrophages in response to the pro-inflammatory environment. M1 macrophages not only differentiate into mature osteoclasts but also secrete pro-inflammatory cytokines that promote bone resorption. OC-STAMP is induced by RANKL during the formation of mouse monocyte–macrophage leukemia (RAW264.7) cells and osteoclasts, playing a crucial regulatory role in the pathogenesis of Silicosis. SiO₂ deposited near fine bronchioles and alveoli are initially phagocytosed by lung macrophages, serving as primary immune barriers. Nevertheless, macrophages can be subdivided into three distinct subpopulations: AMs located inside the alveoli, IMs located midway between the pulmonary epithelium and blood vessels, and mononucleated macrophages (monocytes) present in the vasculature [34]. AMs are a type of tissue-resident macrophage, known for their potent phagocytosis and production of antimicrobials, TNF-α, and nitric oxide (NO) against various pathogens. They play crucial roles in lung development, surfactant homeostasis, pathogen clearance, and immune system stabilization [35, 36]. IMs are generally regarded as generated from monocytes in the bone marrow after differentiation and have an immunomodulatory role in lung tissues through the secretion of IL-10, IL-1, and IL-6 [37, 38]. In our study, we observed no significant difference in the number of AMs between the sham and Si-OC groups. However, the proportion of AMs decreased in the SiO₂ + Si-OC group, although these differences were not statistically significant. We also observed no significant change in the number of IMs between the sham and Si-OC groups. However, the proportion of IMs decreased in the SiO₂ group and increased in the SiO₂ + Si-OC group. These results indicate that in response to SiO₂, the proportion of AMs increased, while that of IMs decreased. This suggests that some of the increased IMs acquired tissue-resident properties in response to SiO₂ exposure, indicating that circulating monocytes contributed to the pool of tissue-resident macrophages.

In addition, M1/M2 polarization of macrophages plays a key role in Silicosis fibrosis. Macrophages can be categorized according to their activation pathways into classically activated macrophages (M1) and alternatively activated macrophages (M2) [34]. During the acute inflammatory phase, M1 macrophages are activated to eliminate pathogenic microorganisms and promote the inflammatory response. However, during the fibrotic phase, M1 macrophages are transformed into M2 macrophages with anti-inflammatory functions, further accelerating pulmonary fibrosis development [34, 39]. In this study, we used flow cytometry to analyze the proportions of CD86+, MHCII+, and CD206+ cells representing M1 and M2 macrophages in AMs (CD45+F4/80+CD11c+). We found that the proportions of CD86+ and MHCII+ cells were significantly increased in AMs in the SiO₂ group compared to those in the sham group, whereas the proportion of CD206+ cells decreased in both AMs and IMs. Notably, the SiO₂ + Si-OC combination reversed these effects. These findings reveal that OC-STAMP can induce SiO₂ to polarize AMs toward M1 macrophages in the lungs of C57BL/6 mice while decreasing M2 macrophage polarization. This indicates that OC-STAMP contributes to the enhancement of M1 macrophage polarization and the reduction of M2 macrophage polarization, thereby exacerbating the fibrotic process in Silicosis. In our study, 56 days after SiO₂ administration, we performed HE, Masson, and Sirius red staining on lung tissue sections from each group of mice to observe pathological changes. In the SiO₂ group, the formation of silica nodules and fibrosis in the lung interstitium were particularly evident. We also noted an increase in OC-STAMP levels, which led to ferroptosis and further accelerated EMT in mice. This finding was consistent with previous cytological findings in rats with Silicosis. Histopathological changes in the lungs of the Silicosis mice models were mitigated using OC-STAMP siRNA. The interfering effect of OC-STAMP siRNA effectively alleviated pulmonary fibrotic lesions in mice with Silicosis by decreasing OC-STAMP expression and the ferroptosis rate and inhibiting EMT. The ability of OC-STAMP siRNA to reduce the expression level of OC-STAMP triggered by SiO₂ was confirmed using immunohistochemistry and immunoblotting as well as by its ability to reduce the iron mortality phenotype and inhibit EMT and the fibrotic phenotype. Finally, we examined plasma from healthy individuals and patients with Silicosis using ELISA and found that the expression of OC-STAMP in patients with Silicosis was significantly higher than that in healthy individuals. This trend was consistent with observations in animal and cellular experiments, suggesting OC-STAMP as a potential novel biomarker for diagnosing Silicosis. Figure 13 illustrates the mechanism by which OC-STAMP regulates Silicosis fibrosis.

Fig. 13

Mechanism by which OC-STAMP potentiates lung inflammation and fibrosis induced by silica. SiO₂ enters the human body and activates OC-STAMP in alveolar type II epithelial cells. This activation triggers ferroptosis, which leads to epithelial-mesenchymal transition (EMT) and the formation of myofibroblasts. The resulting accumulation of extracellular matrix (ECM) further exacerbates the fibrosis associated with Silicosis.. Pictures were generated using Figdraw

Conclusion

In the present study, we detected abnormalities in OC-STAMP expression, ferroptosis, and fibrosis-related signals in a rat model of Silicosis. We cultured MLE-12 mouse AT2 epithelial cells in vitro to construct an OC-STAMP overexpression model and treated it with Fer-1 to confirm the role of OC-STAMP-induced ferroptosis in fibrosis. We subsequently verified the in vivo regulatory effect of OC-STAMP on Silicosis inflammatory fibrosis by establishing a Silicosis mouse model and administering Fer-1 or  OC-STAMP siRNA. Finally, this study detected the expression of OC-STAMP in the plasma of Silicosis patients. In conclusion, our results provide a new theoretical framework for OC-STAMP as a diagnostic and therapeutic target for Silicosis.

Limitation

This study confirmed for the first time.