Skip to main content
Download PDF

Gut commensal Parabacteroides distasonis exerts neuroprotective effects in acute ischemic stroke with hyperuricemia via regulating gut microbiota-gut-brain axis

Journal of Translational Medicine volume 22, Article number: 999 (2024) Cite this article

Abstract

Background

Hyperuricemia is considered as an independent risk factor for acute ischemic stroke (AIS), and some AIS patients are accompanied by an increase in serum uric acid. Recent studies have highlighted the important role of gut microbiota in both hyperuricemia and AIS, but there is little available data on the relationship between gut microbiota and the pathogenesis of AIS with hyperuricemia (HAS).

Methods

Here we profiled the gut microbiota composition in 63 HAS patients and 269 non-HAS patients through 16s rRNA sequencing. Male rat with hyperuricemia were subjected to middle cerebral artery occlusion (MCAO) to establish HAS model and were then treated with Parabacteroides distasonis. Subsequently, the neurological deficit, pathological damages and blood-brain barrier disruption were evaluated. Moreover, the levels of ROS, inflammatory cytokines, NF-𝜿B pathway related protein, and vascular density markers were determined.

Results

There were significant differences of gut microbiota composition between HAS patients and non-HAS patients, and a significant decrease in the abundance of Parabacteroides in HAS patients compared to non-HAS patients. Animal experiments showed that supplementation with P. distasonis increased beneficial commensal bacteria, significantly improved neurological deficits, pathological damages and BBB disruption, as well as reduced the level of serum uric acid in HAS rats. We further demonstrated that P. distasonis treatment decreased ROS level and increased SOD2 level, thereby reducing oxidative stress. Meanwhile, P. distasonis effectively inhibited NF-𝜿B signal pathway and reduced the production of inflammatory cytokines, including TNF-α and IL-1β, alleviating the inflammatory response. Notably, P. distasonis treatment increased the levels of vascular density markers including cluster of differentiation 31 (CD31) and alpha-smooth muscle actin (α-SMA), ameliorating vascular damage in HAS rats.

Conclusions

Together, these findings highlighted the important role of P. distasonis in the pathogenesis of HAS, and its mechanism was involved in the regulation of gut microbiota-gut-brain axis, which implied a novel strategy against HAS.

Introduction

Acute ischemic stroke (AIS) is the leading cause of disability and death in patients, severely reducing their quality of life [1]. There is growing evidence that hyperuricemia might be involved in the occurrence and progression of cerebrovascular diseases, and is an important risk factor for AIS [2]. The accumulation of uric acid (UA) in the vascular wall could trigger a series of vascular events, including increased vascular permeability, endothelial dysfunction, disruption of the blood-brain barrier (BBB), and vascular inflammation. Recent studies have shown that UA could increase oxidative stress and enhance vascular endothelial cell apoptosis in rats with middle cerebral artery occlusion [3]. Increasing evidence demonstrated that gut microbiota has been proven to play vital roles in both hyperuricemia and AIS. Our previous studies have shown that the composition of the gut microbiota in AIS patients with H-type hypertension were significantly different compared with AIS patients without H-type hypertension [4], and gut microbial in lacunar cerebral infarction patients were significantly different compared with control groups [5]. In addition, the composition and function of gut microbiota in patients with hyperuricemia have also undergone significant changes [6], suggested that abnormal gut microbiota have participated in the pathogenesis of AIS with hyperuricemia. Remarkably, the alteration of the gut microbiota with probiotics treatment could improve the dysbiosis of gut microbiota induced by hyperuricemia and reduce UA levels in animal models [7, 8]. One of the effective means to regulate abnormal gut microbiota is probiotics, which could confer healthy benefits to AIS with hyperuricemia.

Parabacteroides distasonis (P. distasonis), a member of the genus Parabacteroides, is a commensal bacterium that colonized the gastrointestinal tract of humans and animals [9], which possessed many beneficial effects. It was reported that P. distasonis treatment could ameliorate rheumatoid arthritis pathogenesis in mice [10]. Zhao et al. reported that P. distasonis is decreased in patients with hepatic fibrosis, and that administration of P. distasonis supplementation improved hepatic fibrosis [11]. Moreover, P. distasonis supplementation could regulate abnormal gut microbiota and enhance intestinal barrier function and improves insulin resistance by activating intestinal G protein coupled receptor 109a (GPR109a) [12]. Recent study shown that oral administration of P. distasonis F1-2 strain could decrease inflammation and colonic hypersensitivity in visceral pain mouse models [13]. These considerations suggest that the regulation of the abnormal gut microbiota-gut-brain axis by P. distasonis might help prevent oxidative stress and inflammatory response in HAS.

In this study, we delved into the connection between P. distasonis and HAS, and its mechanisms within the context of HAS. Our results performed an integrative analysis of profiling data from HAS patients, revealing a deficiency of P. distasonis. We further showed that P. distasonis supplementation reduced oxidative stress, and effectively inhibited NF-𝜿B signal pathway and reduced inflammatory response. Notably, P. distasonis treatment ameliorated vascular damage in HAS rats. These findings provided an insight into the direct link between P. distasonis and HAS, offering a novel strategy against HAS.

Materials and methods

Subject recruitment and sample collection

A total of 63 HAS patients and 269 non-HAS patients were recruited from the Department of Neurology of the Second Affiliated Hospital of Wenzhou Medical University, from September 2020 to July 2021. Inclusion criteria: patients diagnosed with AIS; admission within 72 h after stroke onset. AIS with hyperuricemia diagnosed by serum UA ≥ 417 µmol/L in men and ≥ 357 µmol/L in women [14]. Exclusion criteria: combined disorders of consciousness, mental or communication disorders, severe complications, history of other central nervous system diseases, primary gout, renal or renal tubular diseases, recent use of drugs affecting UA metabolism within 1 week before treatment, antibiotic or probiotic use within 3 months, or failure to complete follow-up. A poor outcome was defined as the mRS score > 2 after 3 months of follow-up. Fecal samples were collected from patients within 48 h of hospitalization. All experiments were approved by the Ethics Committee of the Second Affiliated Hospital of Wenzhou Medical University (LCKY2020-207).

Animals and treatment

Male SD rats (210–230 g) were purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd. Zhejiang, China. Throughout the experiment, the rats were kept under consistent environmental conditions with a temperature of 25 ± 2 °C, humidity of 55 ± 5%, and a 12-hour light/dark cycle lighting system. The rats had ad libitum access to food and water in the cages. All study procedures were approved by the Animal Ethics Committee of Wenzhou Medical University.

Induction of HAS model rat

The rats were gavaged with Potassium Oxonate (PO, 750 mg/kg) once daily for 7 days to establish the hyperuricemia model. Then, the hyperuricemia rats underwent middle cerebral artery occlusion (MCAO), leading to cerebral ischemia/reperfusion injury. The MCAO procedure was performed as described previously [15]. The sham-operated mice underwent identical surgical procedures without arterial ligation or insertion of suture for occlusion. Serum UA level was detected with uric acid test kit (Nanjing Jiancheng Bioengineering Institute).

Experimental design

The hyperuricemia rats were randomly divided into three groups: Sham group (n = 11), HAS group (n = 11), and HAS + Pd group (n = 11). Then, in the HAS + Pd group, the rats were intragastrically treated with P. distasonis BNCC 354,946. P. distasonis BNCC 354,946 strain was purchased from BeNa Culture Collection Co., Ltd., Suzhou, China. P. distasonis BNCC 354,946 was cultured in Brain Heart Infusion broth medium (BHI) at 37 °C in an anaerobic chamber for 48 h, centrifuged and resuspended in sterile physiological saline at a concentration of 1 × 108 CFU mL− 1. The HAS + Pd rats were treated intragastrically with P. distasonis BNCC 354,946 following MCAO at a dose of 2 mL once daily. Sham and HAS rats also received the same physiological saline daily.

Neurological function assessment

Post-stroke neurological deficits were evaluated using Zea-longa score [16] and Garcia score [17]. Zea-longa score, ranging from 0 to 4, assesses motor coordination, reflexes, and sensory perception, with higher scores indicating more severe neurological deficits. Garcia score comprises six aspects, including spontaneous activity, posture symmetry, forelimb outstretching, climbing, body proprioception and whisker stimulation. It ranges from 3 to 18 points, with higher scores indicating better neurological function and recovery. The assessment was conducted at days 1st, 3th, 5th and 7th post-MCAO modeling, selecting rats with Zea-longa scores of 1–3 and Garcia scores of 7–13 for further experiment.

TTC staining

After completing the behavioral tests, the rats were euthanized, and brain tissues were isolated and frozen at -20 °C for 20 min. Subsequently, brain tissues were carefully cut into 2 mm coronal sections and stained with 2% TTC (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) at 37 °C in darkness for 15 min and fixed in 4% paraformaldehyde (PFA) for 12 h. Following fixation, the stained sections were photographed and the infarct volume was determined by Image J software. Non-infarcted areas were characterized by a deep red coloration, while infarcted lesions appeared pale (within the MCA territory), confirming the success of the model production.

HE staining

The brain tissues of rats were removed, immersed in 4%PFA for 72 h, transferred to 70% alcohol solution, dehydrated by gradient alcohol, transparentized by xylene, embedded in paraffin, and then cut into 5 μm thick coronal cross-sections using a paraffin slicing machine (Thermo USA). The sections were stained with hematoxylin for 8 min, incubated in acidic liquid alcohol for 3 s, stained with eosin for 5 s, dehydrated with gradient alcohol, and finally cleared with xylene and fixed with neutral resin. The images were captured using a microscope (Leica, Buffalo Grove, IL, USA) and the quantitative analysis of the images was performed using image J.

Assay of ROS

ROS levels were measured by 2,7-Dichlorofuorescin Diacetate (DCFH-DA) staining (E004-1-1, Jiancheng, Nanjing, China). The brain tissue (50 mg) was homogenized in 0.5 mL homogenization buffer A, centrifuged at 12, 000 rpm at 4 °C for 3 min, and the supernatant was collected. Subsequently, 10 µM DCFH-DA was added to the supernatant and reacted at 37 °C for 30 min. Fluorescent intensity for the conversion of DCFH-DA to fluorescent product DCF was recorded by excitation at 488 nm and emission at 525 nm using a PerkinElmer Multimode plate Reader, and calculate the fluorescence value/total protein ratio for each sample.

Immunofluorescence

The sections were incubated with 0.3% Triton X-100 for 15 min, sealed with 5% BSA for 1 h, and then incubated with Occludin (1: 400, Proteintech, Rosemont, USA), ZO-1 (1: 50, Santa Cruz Biotechnology, USA), cluster of differentiation 31 (CD31, 1: 200, Invitrogen, California, USA) and alpha-smooth muscle actin (α-SMA, 1: 200, HUABIO, Hangzhou, China) at 4 °C overnight. After washing with PBS for 3 × 5 min, the sections were incubated with the fluorescent secondary antibody at 37 ℃ for 30 min. The sections were sealed using an Antifade Mounting Medium with DAPI, and the images were photographed and analyzed with a fluorescence microscope.

Western blot

The rats were euthanized after behavioral tests, the brain tissues were extracted, then isolated and preserved at -80 °C. The proteins were extracted from the peri-infarct region of rats using RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors (Beyotime, Shanghai, China). Subsequently, the lysate was centrifuged at 12, 000 rpm at 4 °C for 20 min, and the supernatant was collected. After determining and quantifying the protein concentration, the protein samples were denatured by heating, separated by 10–12% SDS-PAGE and transferred to PVDF membranes at 100 V for 70 min. Then, the membranes were sealed with protein free rapid blocking buffer (EpiZyme, Shanghai, China) at room temperature, and incubated with p65 (1: 1000, Bioworld, Louis Park, USA), p-p65 (1: 1000, Bioworld, Louis Park, USA), Occludin (1: 1000, Proteintech, Rosemont, USA), ZO-1 (1: 100, Santa Cruz Biotechnology, USA), IL-1β (1:500, Bioworld, Louis Park, USA), TNF-α (1: 1000, Bioworld, Louis Park, USA), SOD2 (1: 1000, Bioworld, Louis Park, USA), CD31 (1: 1000, ABclonal, Wuhan, China), α-SMA (1: 5000, HUABIO, Hangzhou, China) and β-actin (1: 1000, Bioworld, Louis Park, USA) at 4 °C. After washing with 1 × TBST for 3 × 5 min, the membranes were incubated with the second antibody (1: 5000, Beyotime, Shanghai, China) at room temperature for 1 h. The antibody reactivity was detected through ECL (Biosharp, Hefei, China) and quantified with Image J software. β-actin was used as the internal control.

Fecal 16s rRNA-sequencing in human and rat samples

The fecal microbial DNA was extracted through the OMEGA-soil DNA Kit (Omega Bio-Tek, Norcross, GA, USA) and assessed for concentration and purity through 1% agarose gel electrophoresis. Subsequently, the V3 - V4 hypervariable region of the bacterial 16s rRNA gene was amplified through PCR (ABI GeneAmp9700, USA) with primers: 341 F-806R. The primers used for P. distasonis were as follows: Forward (F): GGACACGTCCCGCACTTTAT, and Reverse (R): TTCTGAGAGGAAGGTCCC. The PCR products were purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA), and quantified with a QuantiFluor™-ST (Promega, USA), and then processed to construct a sequencing library employing the NEXTFLEX Rapid DNA-SEQ Kit (BIOO SCIENTIFIC, USA) with added index codes. The purified gene sequences were sequenced on the Illumina MiSeq platform (Illumina, San Diego, USA), and the validated data were utilized for clustering amplicon sequence variants (ASVs) and taxonomic classification. According to the clustering results of the ASVs, the identification and abundance of taxon were determined, with each ASV sequence annotated. Bioinformatics analysis of fecal microbiota, including diversity analysis, species compositions, and LEfSe analysis, with thresholds of LDA score > 2.0, was analyzed on the Majorbio Cloud Platform.

Statistics

The data were analyzed by SPSS 26.0 (IBM, USA) and plotted with GraphPad Prism V.7.0 (La Jolla, California, USA). The Kolmogorov-Smirnov test was performed to check the normality of all data, and appropriate statistical methods were used for analysis. Categorical variables were expressed as numbers with percentages, and continuous variables are expressed as mean ± standard error (SEM) or median with quartile distance (IQR). Independent sample t-test or Mann-Whitney rank sum test were used for continuous variables, and chi-square test was used for categorical variables. One-way analysis of variance (ANOVA) or Kruskal-Wallis H test were used to analyze the differences among the three groups of data. The relationship between gut microbiota and serum UA level was analyzed by linear regression analysis. P value < 0.05 was considered statistically significant.

Results

Gut commensal Parabacteroides was reduced in HAS patients and positively correlated with prognosis

This study enrolled 332 patients diagnosed with AIS, of whom 63 patients were assigned to the HAS group and 269 to the non-HAS group. The clinical demographics of HAS and non-HAS patients are presented in Table 1. As shown in Fig. 1A and B, there was no statistically significant differences in alpha diversity between two groups (p = 0.392 and 0.1468, respectively), implying the species richness and diversity of gut microbiota in HAS patients remained largely unaltered compared to non-HAS group. Employing Venn diagram analysis, we identified a distinct variance in gut microbiota composition, with a total of 1797 ASVs shared, and 842 ASVs unique to HAS group (Fig. 1C). Further analyzing the genus-level composition of gut microbiota (Fig. 1D), we observed a reduction in the abundance of Parabacteroides in the HAS group in comparison to non-HAS group. Additionally, this discrepancy was corroborated by LEfSe analysis (Fig. 1E). The decreased proportion of Parabacteroides was statistically significant in the HAS group compared with non-HAS group (p = 0.00476, Fig. 1F). Considering the clinical severity of HAS, we assessed the mRS, revealing a statistically significant difference between two groups (P < 0.05, Fig. 1G). This discrepancy underscores a poorer prognosis in the HAS group.

Table 1 The comparison of clinical parameters between HAS patients and non-HAS patients
Full size table
Fig. 1
figure 1

Parabacteroides is associated with the prognosis of HAS patients. (A - B) ACE index and Shannon index were used to evaluate alpha diversity of gut microbiota. (C) Venn diagram illustrated the discrepancy and overlap of ASVs in gut microbiota. (D) Stacked bar chart displayed the composition of different taxa and relative abundance at the genus level between two groups. (E) LEfSe analysis showed the taxonomic data with significant differences at the genus level between two groups. LDA scores > 2.0 were shown. (F) Wilcoxon rank-sum test bar plot on genus level showed the significant level of different bacteria between two groups. (G) Comparisons of mRS score between two groups. Data represented as Mean ± SEM. *P < 0.05 vs. non-HAS group; **P < 0.01 vs. non-HAS group

Full size image

P. distasonis improved abnormal gut microbiota in HAS rats

As shown in Fig. 2A, the relative abundance of P. distasonis was significantly lower in the Sham group than HAS group (P > 0.05), while it was notably higher in the HAS + Pd group than HAS group (P > 0.05), indicating the successful establishment of P. distasonis colonization in the intestine. We next measured the serum UA level among three groups (Fig. 2B). The UA level in the HAS group was significantly increased compared with Sham group (P > 0.01). However, the UA level was markedly decreased after P. distasonis administration (P > 0.05), indicating that P. distasonis reduces UA. Ace index and Shannon index showed that there were no significant differences in the richness and diversity of gut microbiota among the three groups (Fig. 2C and D). In addition, principal coordinate analysis (PCoA) revealed distinguishable structures and compositions of gut microbiota among three groups (Fig. 2E). Regarding bacterial composition at the genus level (Fig. 2F). Notably, an increase in the abundance of P. distasonis was observed in the HAS + Pd group compared with HAS group.

Fig. 2
figure 2

P. distasonis reversed abnormal gut microbiota of HAS rats. (A) Comparisons of relative abundance of P. distasonis among Sham group, HAS group and HAS + Pd group. (B) Comparisons of serum UA level among three groups. (C - D) Ace index and Shannon index were used to evaluate α-diversity among three groups. (E) PCoA analysis showed variations of gut microbiota composition among three groups. The significant p value was indicated, and each character represented a sample. (F) Stacked bar chart displayed the composition of different taxa and relative abundance at the genus level among three groups. *P < 0.05 vs. Sham group; **P < 0.01 vs. Sham group; #P < 0.05 vs. HAS group

Full size image

P. distasonis improved neurological deficits and ameliorated morphological damages after cerebral I/R injury in HAS rats

To assess the effect of P. distasonis treatment on neurological function, Zea-Longa score and Garcia score on days 1st, 3th, 5th and 7th post-MCAO were measured. P. distasonis treatment reduced the Zea-Longa score in the HAS + Pd group compared with HAS group, showing statistical significance on day 7 (P < 0.05, Fig. 3A), while significantly increasing the Garcia score on days 5 and 7 compared with HAS group (P < 0.01, Fig. 3B), indicating that P. distasonis treatment promotes the recovery of neurological function in HAS rats.

Fig. 3
figure 3

P. distasonis improved neurological deficits and ameliorated morphological damages in HAS rats. (A) Comparisons of Zea-Longa scores among Sham group, HAS group and HAS + Pd group. (B) Comparisons of Garcia scores among three groups. (C) Representative images of brain sections stained with TTC among three groups. (D) Percentage of cerebral infarction volume among three groups. (E) Representative images of HE staining, Magnification: 50 ×, Scale bar: 800 μm, and more detailed views of HE staining images, Magnification: 400 ×, Scale bar: 100 μm. Data represented as Mean ± SEM. #P < 0.05 vs. HAS group, ##P < 0.01 vs. HAS group

Full size image

TTC staining showed that the brain sections in the Sham group were deep red and there were no infarctions, whereas the noticeable infarct areas were evident in the HAS group (Fig. 3C and D), indicating successful modeling of MCAO. Interestingly, the infarct volume in the HAS + Pd group was significantly reduced compared with HAS group (P < 0.01). Furthermore, in HE staining (Fig. 3E), the cortex tissue histopathology in the Sham group revealed normalcy, characterized by regularly arranged neurons and glial cells. Conversely, tissue structure disruption, disorganized nerve cells, and a large number of necrotic cells were observed in the HAS group. However, P. distasonis treatment showed a reduction in neuronal necrosis and an amelioration of morphology changes compared with HAS group.

P. distasonis treatment alleviated BBB disruption in HAS rats

As shown in Fig. 4A and B, the Occludin and ZO-1 expression levels were visibly decreased in the HAS group compared with Sham group, while they were increased after P. distasonis administration. Meanwhile, in western blot, the levels of Occludin and ZO-1 in the HAS group were significantly decreased compared with Sham group (Occludin: P < 0.05; ZO-1: P < 0.01, Fig. 4C, D and E), which was increased markedly in the HAS + Pd group than HAS group (Occludin: P < 0.05; ZO-1: P < 0.01, Fig. 4C, D and E), indicating that P. distasonis could alleviate BBB disruption in HAS.

Fig. 4
figure 4

P. distasonis alleviated the disruption of the BBB in HAS rats. (A - B) Representative immunofluorescence images of Occludin and ZO-1. Magnification: 400 ×, Scale bar: 100 μm. (C) Representative Western blot images of Occludin and ZO-1. (D - E) Relative quantification of Occludin and ZO-1. The ratios of Occludin/β-actin and ZO-1/β-actin in the Sham group were used as the reference values. Data represented as Mean ± SEM. *P < 0.05 vs. Sham group; **P < 0.01 vs. Sham group; #P < 0.05 vs. HAS group, ##P < 0.01 vs. HAS group

Full size image

P. distasonis mitigated oxidative stress and inflammation in HAS rats

The ROS level was markedly elevated in the HAS group compared with Sham group (P < 0.01, Fig. 5A), which showed a significant reduction after P. distasonis treatment (P < 0.05, Fig. 5A). Meanwhile, the level of SOD2 in the HAS group was significantly decreased compared with Sham group (P < 0.01, Fig. 5B and F), whereas P. distasonis treatment markedly increased the SOD2 level (P < 0.05, Fig. 5B and F).

Fig. 5
figure 5

P. distasonis mitigated oxidative stress and inflammation in HAS rats. (A) Quantification of relative ROS level. (B) Representative Western blot images of oxidative stress and inflammation related proteins, such as p-p65, p65, IL-1β, TNF-α and SOD2. (C - F) Quantitative analysis of oxidative stress and inflammation related proteins. The ratios of p-p65/p65, IL-1β/β-actin, TNF-α/β-actin and SOD2/β-actin in the Sham group were used as the reference values. Data represented as Mean ± SEM. **P < 0.01 vs. Sham group; #P < 0.05 vs. HAS group, ##P < 0.01 vs. HAS group

Full size image

The ratio of p-p65/p65 was significantly increased in the HAS group compared with Sham group (P < 0.01, Fig. 5B and C), while the ratio was substantially decreased after P. distasonis administration (P < 0.01, Fig. 5B and C). Additionally, as shown in Fig. 5B, D and E, the IL-1β and TNF-α levels in the HAS group were significantly increased compared with Sham group (IL-1β: P < 0.01; TNF-α: P < 0.01), with a remarkable increase observed after P. distasonis administration (IL-1β: P < 0.05; TNF-α: P < 0.01).

P. distasonis ameliorated vascular damage in HAS rats

Immunofluorescence staining results showed a reduction in CD31 and α-SMA expression in the HAS group compared with Sham group (Fig. 6A). However, P. distasonis treatment exhibited an augmentation in vascular density, as evidenced by increased expressions of CD31 and a-SMA. Aligning with the western blot results shown in Fig. 6B, C and D, the CD31 and α-SMA levels were significantly decreased in the HAS group compared with Sham group (CD31: P < 0.01; α-SMA: P < 0.01). However, there was a substantial increase in CD31 and α-SMA levels after P. distasonis treatment (CD31: P < 0.01; α-SMA: P < 0.01). Mechanism diagram showed that P. distasonis improved HAS pathology by regulating the gut-brain axis.(Fig. 7).

Fig. 6
figure 6

P. distasonis ameliorated vascular damage in HAS rats. (A) Representative immunofluorescence images of CD31 and α-SMA. Magnification: 400 ×, Scale bar: 100 μm. (B) Quantification of relative intensity of CD31 positive vessels. (C) Quantification of relative intensity of α-SMA positive vessels. (D) Representative Western blot images of CD31 and α-SMA. (E - F) Relative quantification of CD31 and α-SMA. The ratios of CD31/β-actin and α-SMA/β-actin in the Sham group were used as the reference values. Data represented as Mean ± SEM. *P < 0.05 vs. Sham group; **P < 0.01 vs. Sham group; #P < 0.05 vs. HAS group, ##P < 0.01 vs. HAS group

Full size image
Fig. 7
figure 7

Mechanism diagram. P. distasonis attenuates vascular damage, oxidative stress and inflammation in HAS by regulating gut-brain axis

Full size image

Discussion

In this study, we observed a markedly decreased abundance of Parabacteroides in HAS patients, and P. distasonis supplementation could increase beneficial commensal bacteria, significantly improve neurological deficits, pathological damages and BBB disruption, as well as reduce the level of serum UA in the HAS rats. Moreover, P. distasonis treatment decreased ROS level and increased the SOD2 level, inhibited NF-𝜿B signal pathway and alleviated the inflammatory response. Notably, P. distasonis treatment increased the levels of vascular density markers including CD31 and α-SMA, ameliorating vascular damage in HAS rats. These findings suggested that P. distasonis could ameliorate oxidative stress, inflammatory response and vascular damage in HAS: involvement of the gut-brain axis.

Parabacteroides, classified with the Bacteroidetes phylum, is considered a prevalent species of the human gut microbiota, with a beneficial effect on the host [10, 11, 18]. We observed a significant decrease in the abundance of Parabacteroides in HAS patients. In non-HAS patients, Parabacteroides was dominant bacteria [19], while in HAS patients, dominant bacteria primarily included opportunistic pathogens, such as Cetobacterium, Ruminococcus_torques_group [20, 21]. P. distasonis treatment promoted the neurological function recovery of HAS rats. In rats after MCAO surgery, a notable brain infarct was observed alongside reduced neuron count, destructed neuron structure, and vacuolated spaces [22]. We assessed the post-MCAO infarction area using TTC staining, a dependable marker of brain damage, and interestingly, P. distasonis treatment demonstrated a discernible effect on improving brain injury. Previous studies have indicated that the regulation of gut microbiota could mitigate the apoptosis and necrosis of hippocampal neurons [23]. Furthermore, probiotics have been shown to eliminate MCAO-induced sensorimotor and motor deficits, as well as reduce infarct volume and neuronal death in the ipsilateral hemisphere [24]. In this study, P. distasonis effectively improved neuronal damage in HAS rats, and increased the levels of ZO-1 and Occludin. TJ, formed by the interaction of transmembrane proteins (claudins and Occludin) with complementary proteins on adjacent cells, create a seal-like barrier, while cytoplasmic proteins (ZO-1, ZO-2 and cingulin) link transmembrane proteins to the actin cytoskeleton, providing structural support and stability to the junctions [25].

Vascular damage is a key pathogenesis mechanism of HAS. Vascular damage could precipitate thrombus formation, blocking normal blood flow and causing local ischemia, thus inducing the occurrence of stroke [26]. Concurrently, vascular damage and ensuing thrombi can inflict damage or demise upon adjacent neuronal cells, thereby eliciting neurological deficits and even disabilities. In this study, we investigated the expressions of CD31 and α-SMA, the markers indicative of vascular endothelial cells and smooth muscle cells respectively [27], reflecting the degree of vascular damage. P. distasonis significantly enhanced the expressions of CD31 and α-SMA, suggesting an amelioration of vascular damage in HAS. Elevated UA levels can lead to vascular damage through mechanisms such as promoting oxidative stress and inflammatory responses, thereby increasing the risk of stroke. Elevated serum UA levels can paradoxically lead to oxidative stress damage [28, 29], promoting ROS production, while also inhibiting SOD activity, resulting in cellular damage and vascular wall injury. In this study, we demonstrated that P. distasonis treatment reduced the ROS production and enhanced SOD2 activity, indicating that P. distasonis mitigated oxidative stress in HAS. It has been reported that elevated UA levels activated endothelial cell oxidative stress, thereby inhibiting Akt phosphorylation, and impeding UA efflux, consequently exacerbating UA accumulation within endothelial cells [30]. Furthermore, excessive UA accumulating on the vascular wall can stimulate macrophages and other immune cells to release potent inflammatory factors such as IL-1β and TNF-α [31, 32], thereby triggering an inflammatory response [33] and causing endothelial cell damage. Pervious study demonstrated that repeated induction of hyperuricemia in mice could lead to increased TNF-α production after LPS [34]. Interestingly, after uptake by vascular endothelial cells, UA can rapidly induce nuclear translocation and activation of NF-𝜿B, stimulating the production of chemokines and adhesion molecules, which in turn promote the migration and adhesion of monocytes to endothelial cells, leading to an increase in the release of inflammatory cytokines [35]. Meanwhile, UA can stimulate vascular smooth muscle cells to express pro-inflammatory factors such as monocyte chemoattractant protein-1 and NF-𝜿B [36]. Recent studies have shown that P. distasonis treatment reduced the pro-inflammatory signaling pathway by repairing the gut barrier and mitigating inflammation caused by gut microbiota disturbances [10, 11, 37]. P. distasonis could regulate innate inflammatory responses through inhibiting the release of TNF-α, IL-6, IL-17, IL-12 or IFN-γ [38]. Moreover, P. distasonis has been demonstrated to diminish the capacity of brain glial cells to secrete pro-inflammatory IL-6, showcasing it potential for regulating inflammation and exhibiting antioxidant properties in vitro [39]. P. distasonis is generally considered to be beneficial to human physiology and is used to enhance gastrointestinal barrier function and anti-inflammation. This contrasts with former studies, a pathogenic role in the P. distasonis in ankylosing spondylitis and coronary artery disease have been reported [40, 41]. This inconsistency could be explained either by different methodological approaches or by a weak effect. There is something remarkable about the gut microbiota that triggers events leading to inflammation. Our findings indicate that P. distasonis treatment significantly inhibited the expression levels of IL-1β, TNF-α and NF-𝜿B signaling pathway related proteins, thereby reducing inflammation in HAS. The pathogenesis of acute ischemic stroke with hyperuricemia is complex, and the signaling has not been fully elucidated. Therefore, more extensive research is required to further investigate the mechanism of P. distasonis in acute ischemic stroke with hyperuricemia. Most of the existing studies are conducted in animals, and few are in clinical trials. Translating the findings from bench to bedside is extremely challenging because of the genetic differences between humans and animals.

In conclusion, integrating the profiling of gut microbiota and clinical features could provide a deep understanding of specific bacteria and HAS. Our findings suggested that P. distasonis supplementation improve neurological deficits, pathological damages and BBB disruption, as well as reduce the level of serum UA in the HAS rats. P. distasonis might be involved in the suppression of oxidative stress, inflammatory response and vascular damage through regulating gut-brain axis. Our study findings provided insights relationship between gut microbiota and HAS, and suggested potential therapeutic avenues for P. distasonis in neuroprotective effects of HAS.

Data availability

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

References

  1. Global regional. <ArticleTitle Language=“En”>national burden of stroke and its risk factors, 1990–2019: a systematic analysis for the global burden of Disease Study 2019. Lancet Neurol. 2021;20:795–820.

    Article  Google Scholar 

  2. Irfan M, Jawaid W, Hashmat O, Nisa Q, Khastoori DR 2nd, Shahbaz NN. Association Between Hyperuricemia and Acute Ischemic Stroke in Patients at a Tertiary Care Hospital. Cureus. 2020;12:e10899.

  3. Song C, Zhao X. Uric acid promotes oxidative stress and enhances vascular endothelial cell apoptosis in rats with middle cerebral artery occlusion. Biosci Rep 2018, 38.

  4. Yu S, Chen J, Zhao Y, Liao X, Chen Q, Xie H, Liu J, Sun J, Zhi S. Association analysis of the gut microbiota in predicting outcomes for patients with acute ischemic stroke and H-type hypertension. Front Neurol. 2023;14:1275460.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Ma J, Xie H, Yuan C, Shen J, Chen J, Chen Q, Liu J, Tong Q, Sun J. The gut microbial signatures of patients with lacunar cerebral infarction. Nutr Neurosci. 2024;27:620–36.

    Article  PubMed  Google Scholar 

  6. Wang J, Chen Y, Zhong H, Chen F, Regenstein J, Hu X, Cai L, Feng F. The gut microbiota as a target to control hyperuricemia pathogenesis: Potential mechanisms and therapeutic strategies. Crit Rev Food Sci Nutr. 2022;62:3979–89.

    Article  PubMed  CAS  Google Scholar 

  7. Wu Y, Ye Z, Feng P, Li R, Chen X, Tian X, Han R, Kakade A, Liu P, Li X. Limosilactobacillus fermentum JL-3 isolated from Jiangshui ameliorates hyperuricemia by degrading uric acid. Gut Microbes. 2021;13:1–18.

    Article  PubMed  Google Scholar 

  8. Zhao H, Chen X, Zhang L, Meng F, Zhou L, Pang X, Lu Z, Lu Y. Lacticaseibacillus rhamnosus Fmb14 prevents purine induced hyperuricemia and alleviate renal fibrosis through gut-kidney axis. Pharmacol Res. 2022;182:106350.

    Article  PubMed  CAS  Google Scholar 

  9. Wang SX, Summage-West CV, Kim SG. Complete genome sequence of Parabacteroides distasonis strain GP102, isolated from the cecum of a morbid pregnant laboratory guinea pig (Cavia porcellus). Microbiol Resour Announc. 2024;13:e0125923.

    Article  PubMed  Google Scholar 

  10. Sun H, Guo Y, Wang H, Yin A, Hu J, Yuan T, Zhou S, Xu W, Wei P, Yin S, et al. Gut commensal Parabacteroides distasonis alleviates inflammatory arthritis. Gut. 2023;72:1664–77.

    Article  PubMed  CAS  Google Scholar 

  11. Zhao Q, Dai MY, Huang RY, Duan JY, Zhang T, Bao WM, Zhang JY, Gui SQ, Xia SM, Dai CT, et al. Parabacteroides distasonis ameliorates hepatic fibrosis potentially via modulating intestinal bile acid metabolism and hepatocyte pyroptosis in male mice. Nat Commun. 2023;14:1829.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  12. Sun Y, Nie Q, Zhang S, He H, Zuo S, Chen C, Yang J, Chen H, Hu J, Li S, et al. Parabacteroides distasonis ameliorates insulin resistance via activation of intestinal GPR109a. Nat Commun. 2023;14:7740.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  13. Gervason S, Meleine M, Lolignier S, Meynier M, Daugey V, Birer A, Aissouni Y, Berthon J, Ardid D, Filaire E, Carvalho F. Antihyperalgesic properties of gut microbiota: Parabacteroides distasonis as a new probiotic strategy to alleviate chronic abdominal pain. Pain. 2024;165:e39–54.

    PubMed  CAS  Google Scholar 

  14. Sun P, Chen M, Guo X, Li Z, Zhou Y, Yu S, Yang H, Sun G, Zheng L, Sun Y. Combined effect of hypertension and hyperuricemia on ischemic stroke in a rural Chinese population. BMC Public Health. 2021;21:776.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Wang FJ, Wang SX, Chai LJ, Zhang Y, Guo H, Hu LM. Xueshuantong injection (lyophilized) combined with salvianolate lyophilized injection protects against focal cerebral ischemia/reperfusion injury in rats through attenuation of oxidative stress. Acta Pharmacol Sin. 2018;39:998–1011.

    Article  PubMed  CAS  Google Scholar 

  16. Longa EZ, Weinstein PR, Carlson S, Cummins R. Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke. 1989;20:84–91.

    Article  PubMed  CAS  Google Scholar 

  17. Garcia JH, Wagner S, Liu KF, Hu XJ. Neurological deficit and extent of neuronal necrosis attributable to middle cerebral artery occlusion in rats. Statistical validation. Stroke. 1995;26:627–34. discussion 635.

    Article  PubMed  CAS  Google Scholar 

  18. Gomez-Nguyen A, Basson AR, Dark-Fleury L, Hsu K, Osme A, Menghini P, Pizarro TT, Cominelli F. Parabacteroides distasonis induces depressive-like behavior in a mouse model of Crohn’s disease. Brain Behav Immun. 2021;98:245–50.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  19. Ji X, Zhu L, Chang K, Zhang R, Chen Y, Yin H, Jin J, Zhao L. Chitooligosaccahrides: Digestion characterization and effect of the degree of polymerization on gut microorganisms to manage the metabolome functional diversity in vitro. Carbohydr Polym. 2022;275:118716.

    Article  PubMed  CAS  Google Scholar 

  20. Elsheshtawy A, Clokie BGJ, Albalat A, Beveridge A, Hamza A, Ibrahim A, MacKenzie S. Characterization of External Mucosal Microbiomes of Nile Tilapia and Grey Mullet Co-cultured in Semi-Intensive Pond Systems. Front Microbiol. 2021;12:773860.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Xiang S, Chen J, Deng M, Wang Z, Li X, Lin D, Zhou J. Celastrol ameliorates experimental autoimmune uveitis through STAT3 targeting and gut microenvironment reprofiling. Int Immunopharmacol. 2023;127:111339.

    Article  PubMed  Google Scholar 

  22. Yang L, Su X, Lu F, Zong R, Ding S, Liu J, Wilson G, Li L, Yang Y, Wang W, et al. Serum and brain metabolomic study reveals the protective effects of Bai-Mi-Decoction on rats with ischemic stroke. Front Pharmacol. 2022;13:1005301.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  23. Sun J, Ling Z, Wang F, Chen W, Li H, Jin J, Zhang H, Pang M, Yu J, Liu J. Clostridium butyricum pretreatment attenuates cerebral ischemia/reperfusion injury in mice via anti-oxidation and anti-apoptosis. Neurosci Lett. 2016;613:30–5.

    Article  PubMed  CAS  Google Scholar 

  24. Rahman Z, Bhale NA, Dikundwar AG, Dandekar MP. Multistrain Probiotics with Fructooligosaccharides Improve Middle Cerebral Artery Occlusion-Driven Neurological Deficits by Revamping Microbiota-Gut-Brain Axis. Probiotics Antimicrob Proteins. 2024;16:1251–69.

    Article  PubMed  CAS  Google Scholar 

  25. Hawkins BT, Davis TP. The blood-brain barrier/neurovascular unit in health and disease. Pharmacol Rev. 2005;57:173–85.

    Article  PubMed  CAS  Google Scholar 

  26. De Meyer SF, Langhauser F, Haupeltshofer S, Kleinschnitz C, Casas AI. Thromboinflammation in Brain Ischemia: Recent Updates and Future Perspectives. Stroke. 2022;53:1487–99.

    Article  PubMed  Google Scholar 

  27. Saboor F, Reckmann AN, Tomczyk CU, Peters DM, Weissmann N, Kaschtanow A, Schermuly RT, Michurina TV, Enikolopov G, Muller D, et al. Nestin-expressing vascular wall cells drive development of pulmonary hypertension. Eur Respir J. 2016;47:876–88.

    Article  PubMed  CAS  Google Scholar 

  28. Zhang J, Lin X, Xu J, Tang F. Apelin-13 reduces oxidative stress induced by uric acid via downregulation of renin-angiotensin system in adipose tissue. Toxicol Lett. 2019;305:51–7.

    Article  PubMed  CAS  Google Scholar 

  29. Zhang J, Lin X, Xu J, Tang F, Tan L. CTRP3 protects against uric acid-induced endothelial injury by inhibiting inflammation and oxidase stress in rats. Exp Biol Med (Maywood). 2022;247:174–83.

    Article  PubMed  CAS  Google Scholar 

  30. Komori H, Yamada K, Tamai I. Hyperuricemia enhances intracellular urate accumulation via down-regulation of cell-surface BCRP/ABCG2 expression in vascular endothelial cells. Biochim Biophys Acta Biomembr. 2018;1860:973–80.

    Article  PubMed  CAS  Google Scholar 

  31. Liu-Bryan R, Scott P, Sydlaske A, Rose DM, Terkeltaub R. Innate immunity conferred by Toll-like receptors 2 and 4 and myeloid differentiation factor 88 expression is pivotal to monosodium urate monohydrate crystal-induced inflammation. Arthritis Rheum. 2005;52:2936–46.

    Article  PubMed  CAS  Google Scholar 

  32. Chen CJ, Shi Y, Hearn A, Fitzgerald K, Golenbock D, Reed G, Akira S, Rock KL. MyD88-dependent IL-1 receptor signaling is essential for gouty inflammation stimulated by monosodium urate crystals. J Clin Invest. 2006;116:2262–71.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  33. Oyabambi AO, Areola ED, Olatunji LA, Soladoye AO. Uric acid is a key player in salt-induced endothelial dysfunction: the therapeutic role of Stigma maydis (corn silk) extract. Appl Physiol Nutr Metab. 2020;45:67–71.

    Article  PubMed  CAS  Google Scholar 

  34. Netea MG, Kullberg BJ, Blok WL, Netea RT, van der Meer JW. The role of hyperuricemia in the increased cytokine production after lipopolysaccharide challenge in neutropenic mice. Blood. 1997;89:577–82.

    Article  PubMed  CAS  Google Scholar 

  35. Liang WY, Zhu XY, Zhang JW, Feng XR, Wang YC, Liu ML. Uric acid promotes chemokine and adhesion molecule production in vascular endothelium via nuclear factor-kappa B signaling. Nutr Metab Cardiovasc Dis. 2015;25:187–94.

    Article  PubMed  CAS  Google Scholar 

  36. di Giovine FS, Malawista SE, Thornton E, Duff GW. Urate crystals stimulate production of tumor necrosis factor alpha from human blood monocytes and synovial cells. Cytokine mRNA and protein kinetics, and cellular distribution. J Clin Invest. 1991;87:1375–81.

    Article  PubMed  PubMed Central  Google Scholar 

  37. Liu D, Zhang S, Li S, Zhang Q, Cai Y, Li P, Li H, Shen B, Liao Q, Hong Y, Xie Z. Indoleacrylic acid produced by Parabacteroides distasonis alleviates type 2 diabetes via activation of AhR to repair intestinal barrier. BMC Biol. 2023;21:90.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  38. Kverka M, Zakostelska Z, Klimesova K, Sokol D, Hudcovic T, Hrncir T, Rossmann P, Mrazek J, Kopecny J, Verdu EF, Tlaskalova-Hogenova H. Oral administration of Parabacteroides distasonis antigens attenuates experimental murine colitis through modulation of immunity and microbiota composition. Clin Exp Immunol. 2011;163:250–9.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  39. Ahmed S, Busetti A, Fotiadou P, Vincy Jose N, Reid S, Georgieva M, Brown S, Dunbar H, Beurket-Ascencio G, Delday MI, et al. In vitro Characterization of Gut Microbiota-Derived Bacterial Strains With Neuroprotective Properties. Front Cell Neurosci. 2019;13:402.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  40. Cui Y, Zhang L, Wang X, Yi Y, Shan Y, Liu B, Zhou Y, Lü X. Roles of intestinal Parabacteroides in human health and diseases. FEMS Microbiol Lett 2022, 369.

  41. Liu Z, Li J, Liu H, Tang Y, Zhan Q, Lai W, Ao L, Meng X, Ren H, Xu D, Zeng Q. The intestinal microbiota associated with cardiac valve calcification differs from that of coronary artery disease. Atherosclerosis. 2019;284:121–8.

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work was supported by Wenzhou Science and Technology Research Funds (Y2023124).

Author information

Author notes

  1. Hongming Wei, Lu Zhan and Xinhuang Lv contributed equally to this work.

Authors and Affiliations

  1. Department of Geriatrics, the Second Affiliated Hospital, Yuying Children’s Hospital of Wenzhou Medical University, Wenzhou, Zhejiang, 325027, China

    Hongming Wei, Xinhuang Lv, Yan Lin & Jing Sun

  2. Department of Preventive Medicine, School of Public Health, Wenzhou Medical University, Wenzhou, Zhejiang, 325035, China

    Lu Zhan, Jie Zheng, Wenwen Yang & Jiaming Liu

  3. Department of Neurology, the Second Affiliated Hospital and Yuying Children’s Hospital of Wenzhou Medical University, Wenzhou, Zhejiang, 325027, China

    Songfang Chen

Authors
  1. Hongming Wei
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Lu Zhan
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Xinhuang Lv
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Yan Lin
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Jie Zheng
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Wenwen Yang
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Jiaming Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Jing Sun
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. Songfang Chen
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Hongming Wei and Yan Lin made contributed to conceptualization, validation, and writing of the original draft. Xinhuang Lv, Lu Zhan, Wenwen Yang, Jie Zheng, Jiaming Liu and Jing Sun contributed to data curation, formal analysis, investigation and software. Songfang Chen and Jiaming Liu contributed to funding acquisition, project administration, supervision, and review. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Jing Sun or Songfang Chen.

Ethics declarations

Ethics approval

All experimental procedures were conducted in accordance with institutional guidelines of experimental animals.

Consent for publication

Not applicable.

Conflict of interest

The authors state that there are no conflicts of interest to disclose.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic Supplementary Material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wei, H., Zhan, L., Lv, X. et al. Gut commensal Parabacteroides distasonis exerts neuroprotective effects in acute ischemic stroke with hyperuricemia via regulating gut microbiota-gut-brain axis. J Transl Med 22, 999 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12967-024-05800-9

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12967-024-05800-9

Keywords

Journal of Translational Medicine

ISSN: 1479-5876

Contact us