Mixed active metabolites of the SNP-6 series of novel compounds mitigate metabolic dysfunction-associated steatohepatitis and fibrosis: promising results from pre-clinical and clinical trials

Abstract

Background

Metabolic dysfunction-associated steatohepatitis (MASH) is a growing global health concern with no effective pharmacological treatments. SNP-630, a newly developed synthetic molecule with multiple mechanisms of action, and a mixture of two of its active metabolites (SNP-630-MS) inhibit CYP2E1 expression to prevent reactive oxygen species generation, thereby reducing the accumulation of hepatic triglycerides and lowering chemokine levels. This study investigated the SNP-630’s potential to alleviate the liver injury in MASH and its efficacy in both a mouse model and patients with MASH to identify a drug candidate that targets multiple pathways implicated in MASH.

Methods

SNP-630 and SNP-630-MS were separately administered to the MASH mouse model. The tolerability, safety, and efficacy of SNP-630-MS were also evaluated in 35 patients with MASH. The primary endpoint of the study was assessment of the changes in serum alanine aminotransferase (ALT) levels from baseline to week 12, while the secondary endpoints included the evaluation of liver inflammation, steatosis, and fibrosis parameters and markers.

Results

SNP-630 treatment in mice improved inflammation, liver steatosis, and fibrosis compared with that in the MASH control group. Both SNP-630 and SNP-630-MS treatments markedly reduced ALT levels, hepatic triglyceride content, and the expression of inflammatory cytokines monocyte chemoattractant protein 1 and fibrotic collagen (i.e., Col1a1, Col3a1, and Timp1) in mice. In the clinical trial, patients treated with SNP-630-MS exhibited significant improvement in ALT levels at week 12 compared with baseline levels, with no reports of severe adverse events. This improvement in ALT levels surpassed that achieved with most other MASH candidates. SNP-630-MS demonstrated potential antifibrotic effects, as evidenced by a significant decrease in the levels of fibrogenesis-related biomarkers such as CCL4, CCL5, and caspase 3. Subgroup analysis using FibroScan measurements further indicated the efficacy of SNP-630-MS in ameliorating liver fibrosis.

Conclusions

SNP-630 and SNP-630-MS demonstrated favorable results in mice. SNP-630-MS showed excellent tolerability in mice and patients with MASH. Efficacy analyses indicated that SNP-630-MS improved liver steatosis and injury in patients with MASH, suggesting that SNP-630 and 630-MS are promising therapeutic options for MASH. Larger scale clinical trials remain warranted to assess the efficacy and safety of SNP-630 in MASH.

Trial registration: ClinicalTrials.gov NCT03868566. Registered 06 March 2019-Retrospectively registered, https://clinicaltrials.gov/study/NCT03868566

Background

Metabolic dysfunction-associated steatohepatitis (MASH), also known as non-alcoholic steatohepatitis (NASH), is an advanced stage of metabolic dysfunction-associated steatotic liver disease (MASLD), formerly known as non-alcoholic fatty liver disease (NAFLD) characterized by the accumulation of lipids in liver cells along with inflammation and subsequent fibrosis [1]. MASH can progress to severe conditions such as cirrhosis and hepatocellular carcinoma, posing life-threatening risks. It has been projected that by 2030, the prevalence of MASLD among adults will reach 33.5% [2]. Despite numerous studies conducted to understand the causes of MASLD, no approved pharmacotherapies are currently available [3, 4]. Consequently, there remains an urgent need to identify potential molecular targets for effective treatment by investigating the underlying mechanisms involved in the progression of MASH.

The underlying molecular pathogenesis of MASLD/MASH is complex and has been considered a “multiple-hit” process, which involves multiple parallel factors acting synergistically on the liver and leading to the development or progression of the disease [5]. Therefore, evolving therapeutic targets for MASH has been categorized into four major groups: (1) metabolic targets that reduce insulin resistance, inhibit key enzymes involved in de novo lipogenesis (DNL), or enhance mitochondrial fatty acid β-oxidation [5, 6]; (2) inflammation targets that focus on blocking inflammatory cell infiltration (i.e., macrophage and CD8 T lymphocyte), suppressing inflammatory pathways (i.e., blocking Toll-like receptor 4 or TLR4 signaling), preventing oxidative damage induced by ER stress, or inhibiting hepatocyte cell death [7,8,9]; (3) gut-liver axis targets that involve modulating the enterohepatic circulation of bile acids, modifying the gut microbiome or lowering lipopolysaccharide (LPS) level [10]; and (4) anti-fibrotic targets that directly act on hepatic stellate cells, reduce collagen synthesis, assembly and deposition, or enhance fibrolysis in the liver [11,12,13]. Given the multifaceted nature of MASH progression, targeting a single pathway or molecule may not be sufficient [14,15,16]. There is a growing interest in exploring combination therapies that can simultaneously address different targets involved in the underlying pathogenesis of the disease.

One of the key events in the development of MASLD is insulin resistance, which increases hepatic DNL and impairs the inhibition of adipocyte lipolysis. Together with elevated free fatty acid (FFA) levels in serum, the accumulation of FFA within the hepatocyte increases, which results in steatosis. Ongoing accumulation of FFA leads to endoplasmic reticulum (ER) stress and mitochondrial dysfunction, which induce excessive oxidative stress [17, 18].

Oxidative stress is a major contributor to liver injury and the progression of MASLD, primarily driven by the excessive generation of reactive oxygen species (ROS) through cytochrome P450-2E1 (CYP2E1) mainly in the ER and less in mitochondria [19,20,21,22,23,24,25]. CYP2E1, an enzyme responsible for fatty acid omega-oxidation, plays a significant role in promoting oxidative/nitrosative stress, inflammation, and insulin resistance and has been identified as a critical factor in the development of MASH. Increased levels of CYP2E1 have been observed in patients with steatosis and MASH, particularly in the centrilobular region, which corresponds to the site of maximum hepatocellular injury in MASH. CYP2E1 levels are also elevated in obesity, steatosis, and MASH in both humans and rodents. Animal studies have shown that feeding mice with an AIN-76A western diet significantly induces CYP2E1 expression, leading to the development of MASH and fibrosis. Conversely, CYP2E1-null mice are protected from these detrimental effects [21]. Furthermore, CYP2E1 may contribute to excessive lipid accumulation and worsen oxidative stress, thereby inducing hepatic inflammation and causing various forms of hepatocyte damage and death [26]. Hence, targeting CYP2E1 expression is a potentially effective treatment strategy against MASLD and MASH.

The primary objective of the present study is to assess the effectiveness of SNP-630, a novel synthetic molecule, and its metabolites in treating MASH in both animal models and patients with MASH.

Methods

In vitro metabolism of SNP-630

SNP-630 was added to human blood containing antibacterial agents methylparaben and propylparaben and incubated at 37 ℃. Samples were collected at the indicated time points, mixed with cold acetonitrile, and centrifuged at 4 °C and 13,000 rpm for 5 min. The supernatant was transferred to a tube and stored at − 78 °C until analysis with HPLC–MS/MS.

An LC–MS/MS assay for the determination of SNP-630 and its four metabolites in human plasma was conducted. Briefly, human plasma samples were spiked with internal standard, processed with solid-phase extraction, and analyzed using reversed-phase HPLC with electrospray ionization, Turbo Ion Spray^® MS/MS detection. Negative (M-H)⁻ ions for SNP-630 and Chlorzoxazone-d3 (Internal standard, IS) were monitored in MRM mode. Analyte-to-IS peak area ratios for the standards were used to create a linear calibration curve using 1/x² weighted least-squares regression analysis.

For metabolite 2 (m2) and metabolite 4 (m4) analysis, human plasma samples were spiked with internal standard, processed by solid-phase extraction, and analyzed using reversed-phase HPLC with electrospray ionization, Turbo Ion Spray^® MS/MS detection. Negative (M-H)⁻ ions for m2, m4, m2-d6 (IS), and Chlorzoxazone-d3 (IS) were monitored in MRM mode. Analyte-to-IS peak area ratios for the standards were used to create a linear calibration curve using 1/x² weighted least-squares regression analysis. For m1 and m3 analysis, human plasma samples were spiked with internal standard, processed via acetylation derivatization, and analyzed using reversed-phase HPLC with electrospray ionization, Turbo Ion Spray^® MS/MS detection. Positive (M + H)⁺ ions for m1, m3, and m1-¹³C6 (IS) were monitored in MRM mode. Analyte-to-IS peak area ratios for the standards were used to create a linear calibration curve using 1/x² weighted least-squares regression analysis.

In vivo CYP2E1 activity

In vivo, CYP2E1 activity has been previously described [27]. Briefly, high-fat diet (HFD)-fed mice treated with SNP-630 for 12 weeks were fasted overnight and administered an oral dose of chlorzoxazone (8.33 mg/kg) as a probe. Whole blood was then collected via the tail vein 15 min post-administration and stored at –20 ℃ until analysis. Blood concentrations of chlorzoxazone and 6-hydroxychlorzoxazone were measured using LC/MS/MS as described previously [27]. The activity was described as the blood concentration ratios of 6-hydroxychlorzoxazone to chlorzoxazone.

Experimental animal model

Mice were housed in a pathogen-free environment with a 12 h-light/12 h-dark cycle and free access to food and water. All animal husbandry, care, euthanasia, and use procedures followed the guidelines established by the Institutional Animal Care and Use Committees of the National Defense Medical Center (approval number: IACUC-15-309). MASH was induced in male C57BL/6 (B6) mice. The mice were purchased from the National Laboratory Animal Center (Taipei, Taiwan) at the age of 8–10 weeks and housed at the Laboratory Animal Center of the National Defense Medical Center. The mice were fed with a standard diet of 3–5 g/day, provided water ad libitum for 1–2 weeks, and verified to be healthy before initiation of the study. The weight of the mice was recorded once per week.

SNP-630 treatment

B6 mice were allocated randomly to the blank group, vehicle control high-fat diet (HFD) group, and SNP-630 treatment via oral gavage group. Mice in the blank group (n = 8) were fed with a standard diet (13% calories from fat; Laboratory Autoclavable Rodent Diet 5010, LabDiet, Fort Worth, USA); Mice in the HFD group (n = 8) were fed with HFD (60% calories from fat; Research DIETS D12492) for entire study of 30 weeks. Mice in the SNP-630 treatment groups (n = 8/group) were fed with HFD for the entire study duration (30 weeks) and administered 250, 150, 75, or 25 mg/kg SNP-630 once daily by oral gavage for the last 10 weeks of the experiment.

SNP-630-MS treatment

Male B6 mice were used for the SNP-630-MS treatment efficacy tests. MASH was induced with HFD for 21 weeks. The mice were allocated randomly to the blank group, vehicle control HFD group, and SNP-630-MS treatment via oral gavage group. Mice in the blank group (n = 8) were fed a standard diet; mice in the HFD group (n = 8) were fed with HFD (60% calories from fat; Research DIETS D12492) for 21 weeks; mice in the SNP-630-MS treatment groups (n = 8/group) were also fed with HFD and co-administered 62.5/62.5 or 187.5/187.5 mg/kg SNP-630-MS daily for 21 weeks.

Plasma biochemistry of MASH mice

In the animal models, submandibular blood was collected for biochemical tests. At the end of the study, all mice were weighed and euthanized using CO₂. The blood specimens were allowed to clot at 24 °C for 1 h, and the serum was separated via centrifugation in a refrigerated centrifuge at 15,700 × g and 4 °C for 5 min. Serum ALT levels were subsequently assayed by the National Laboratory Animal Center.

Liver triglyceride (TG) and total cholesterol (TCHO) assays

Animal liver samples were homogenized in 2 mL Folch reagent on ice, centrifuged at 1,977 × g for 20 min at 4 °C, and 1.6 mL of the supernatant was then transferred into a new tube containing 0.8 mL saline. The pellet at the bottom of the centrifuged tube was resuspended in 2 mL of Folch reagent and the mixture was shaken for 20 min, followed by centrifugation at 1,977 × g for 20 min at 4 °C, and 1.6 mL of the supernatant was then transferred to the tube that contained the supernatant from the first-run centrifugation, shaken for 30 s, and centrifuged at 1,977 × g for 20 min at 4 °C. A total of 2 mL of the bottom layer liquid was transferred to a glass container, air dried under a nitrogen stream, and the sample was fully dissolved in EtOH: Triton X-100 (3:1 v:v) with sonication. Liver TG and TCHO levels were analyzed using RANDOX TG and RANDOX CHOL kits, respectively, according to the manufacturer’s instructions. Absorbance measurements were performed using an Epoch 2 Microplate Spectrophotometer (BioTek). Liver TG and TCHO levels were calculated using standard curves and normalized to the weight of the liver in the sample.

Histopathological tissue sectioning, staining, and evaluation

Following euthanasia, approximately 1 cm³ of the largest right lobe of the liver was excised from the same position to eliminate bias due to subjective observation, fixed in 10% neutral formalin, and dehydrated in increasing concentrations of ethanol (30%, 50%, 70%, 95%, and 99.5%), followed by xylene. The fixed tissues were embedded in paraffin and cut into 5-μm sections using a microtome, mounted on clean slides, and dried at 37 °C. To identify lesions, fat accumulation, necrosis, and fibrosis in liver cells due to ongoing liver damage, the liver sections were stained with hematoxylin and eosin (H&E) to evaluate the degree of liver fat accumulation and with Sirius Red to evaluate the degree of fibrosis. Semi-quantitative pathological assessment was performed by a physician or veterinary pathologist in a double-blinded manner to score (NAFLD Activity Score [NAS]). Finally, a differential analysis of the scores for each group was conducted using the Kruskal–Wallis test.

Western blotting

Fifty microgram liver tissues were lysed in RIPA buffer to obtain total proteins, (Cell Signaling Technology, Cat no. 9806) supplemented with protease inhibitors (Roche, Cat no. 5892970001) and phosphatase inhibitors (Roche, Cat no. 4906837001). The samples were incubated for 30 min on ice. Protein concentrations were determined using a BCA Protein Assay Kit (Thermo Fisher Scientific, 23,225). Equal amounts of protein (15 μg) were separated using 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Merck Millipore, IPVH00010). The membranes were blocked with 5% bovine serum albumin (BSA; Sigma-Aldrich, A2058) for 1 h at room temperature and the membranes were incubated with primary antibodies overnight at 4 °C. The utilized primary antibodies were rabbit anti-CYP2E1 (1:1000, Abcam ab28146) and mouse anti-ACTB (1:5000, actin-beta, Abcam ab8226) and secondary antibodies were goat anti-mouse conjugated with HRP (1:10,000, Abcam ab97023), and HRP Donkey anti-rabbit IgG (1:10000, BioLegend Cat no. 406401). The bands were imaged and analyzed with the Image J software (National Institutes of Health, https://imagej.nih.gov/ij/). The relative density was calculated as the ratio of the intensity of the protein of interest to that of ACTB, and all band detection was within the linear range.

Real-time PCR

Total RNA was extracted from 50 mg of mice liver tissue using EasyPure total RNA extraction kit (Bioman Cat no. RT050, Taiwan) and submitted to DNase I treatment (Bioman, Taiwan) according to the manufacturer’s protocol. RNA concentration and purity were evaluated using spectrophotometry (Nanodrop One, Thermo Scientific). RNA (1 μg) was reverse-transcribed using iScript cDNA synthesis kit (Bio-rad Cat no. 1708890, USA) in a 20 μL reaction according to manufacturer’s protocol. 50 ng of cDNA templates was amplified in duplicates using iTaq universal SYBR green supermix (Bio-rad Cat no. 1725124, USA) on a CFX96 Real-Time PCR System (Bio-rad, USA). Transcripts were amplified using the following program: 5 min at 95 ℃ followed by 40 cycles of 10 s at 95 ℃ and 30 s at 60 ℃. Relative mRNA expression was quantified using the 2^−△△Ct method and Gapdh as the housekeeping gene. The following primers were used for Real-Time PCR (5′-3′): Gapdh-Forward: CGTGTTCCTACCCCCAATGT, Gapdh-Reverse: GTTGCTGTTGAAGTCGCAGG, Col1a1-Forward: TTCACCTACAGCACCCTTGT, Col1a1-Reverse:TTGGGGTGGAGGGAGTTTAC, Col3a1-Forward: CGGCTGAGTTTTATGACGGG, Col3a1-Reverse: ATAGGACTGACCAAGGTGGC, Timp1-Forward: TGGCATCTGGCATCCTCTTG, Timp1-Reverse: GGTCTCGTTGATTTCTGGGGA, Acta2-Forward: CCCTGGAGAAGAGCTACGAAC, Acta2-Reverse: GACAGGACGTTGTTAGCATAGAG.

SNP-630-MS clinical study

Study design and patients

We conducted a phase 2 study, comprising a 12-week dosing phase and a 2-week safety follow-up period, in patients with MASH. The individuals enrolled in this study satisfied the following inclusion criteria: (1) age ≥ 20-years-old, body weight ≥ 54 kg, and liver fat content ≥ 10.0% as measured using MRI; (2) phenotypic diagnosis of MASH based on one or more of the following criteria: alanine aminotransferase ALT levels ≥ 1.5 × upper limit of normal (ULN), or ALT ≥ ULN and body mass index (BMI) ≥ 25 and diagnosis of type 2 diabetes mellitus; (3) adequate organ function: hemoglobin ≥ 9 g/dL, platelet count ≥ 100 × 10⁹/L, white blood cell count ≥ 3.0 × 10⁹/L, creatinine clearance ≥ 90 mL/min (determined by the Cockcroft-Gault equation), and serum uric acid < 9.0 mg/dL; and (4) able to provide written informed consent and understand and comply with the requirements of the study.

Individuals were excluded from the study if they met the following exclusion criteria: (1) decompensated or severe liver disease, a history or presence of alcohol abuse, and/or being unable to undergo an MRI scan; (2) having electronically, magnetically, and mechanically activated implanted devices; (3) a significant systemic or major illness other than liver disease; (4) a documented history of a serious allergic reaction to SNP-630-MS or any structurally related compounds; (5) patients with diabetes who did not maintain a stable dose of oral medication for hyperglycemia or had changed their insulin dose by > 10% over the past two months; (6) regularly using agents that are potent against hepatitis or affect lipid metabolism; (7) women who were pregnant or lactating; and (8) women of child-bearing potential who were not committed to taking reliable contraception during their participation in the study and for at least 4 weeks after the end of the study treatment period.

The investigational products (IPs), including study agents and control products, were supplied by the Investigational New Drug (IND) sponsor and shipped to the hospital pharmacy before initiating participant enrollment. We provided the physician investigator with the packaged study agent labeled in accordance with country-specific regulatory requirements. Each open-label period kit contained a supply of IPs sufficient for 5 weeks and 1 week in reserve. The participants were instructed to take a dose, either 800 or 400 mg of SNP-630-MS or the matched placebo once daily after a meal.

The safety profile of the study agent was assessed by monitoring and recording the incidence of treatment-emergent adverse events (TEAEs) and serious TEAEs, whether related to the study treatment or not, as determined by changes in clinical laboratory tests (i.e., hematological and biochemical tests, including iron panels), physical examinations, vital signs, standard electrocardiograms, and any other untoward medical events during the study period. Safety was evaluated for all participants who received at least one dose of study medication.

Primary and secondary endpoints

The primary outcome was the change in serum ALT (also called GPT) at week 12 compared with baseline. This endpoint was based on the US-FDA guidance Noncirrhotic Nonalcoholic Steatohepatitis with Liver Fibrosis: Developing Drugs for Treatment as non-invasive, disease specific biomarker for early phase 2 trials. Secondary outcomes were as follows: (1) percentage changes in ALT, serum aspartate aminotransferase (AST, also called GOT), alkaline phosphatase (Alk-P), gamma-glutamyl transpeptidase (γ-GT), and serum CK-18 fragment levels at week 12 compared with baseline; (2) reduction in liver fat content, measured noninvasively based on the proton density fat fraction (PDFF) on MRI, at completion of week 12 compared with baseline; (3) percentage of patients who experience AE/SAE and those who experience AEs leading to discontinuation at the end of dosing.

Data analysis

Effects of SNP-630 and its metabolites in an animal model of MASH

Data are expressed as means ± standard error (SEM). Statistical significance was determined via one-way analysis of variance using Statistical Package for the Social Sciences, Version 13 (SPSS Inc.). Multiple comparisons were subsequently carried out using post-hoc least significant difference tests to confirm the significance of the differences between groups. Means were considered significantly different at P < 0.05. The statistical differences for total NAS were assessed using the Mann–Whitney U-test.

SNP-630-MS clinical study

To investigate the efficacy and safety of SNP-630-MS in patients with MASH, the primary and secondary endpoints at week 12 were compared with the corresponding baseline values. The primary efficacy analysis compared the percentage reduction in ALT, assuming that the participants who received SNP-630-MS would exhibit a significant reduction in liver fat that was superior to baseline at a significance level of 0.05. The absolute values of the primary endpoint and secondary endpoints at week 12 were also compared with the baseline values using paired t-tests.

Analysis datasets were planned for the “intention-to-treat (ITT)” population, which was the full analysis set (FAS), including all participants who received at least one dose of the study agent. The per-protocol analysis dataset (PP) was used to define the subset of the participants in the FAS who completed their scheduled visits with no missing ALT values at baseline or week 12. participants in the PP dataset must have taken at least 80% of the investigational product for 80% of the days in the study period, with no major violation of the required procedures of the protocol. The safety population included all participants who received at least one dose of the study agent (ITT).

Subgroup analyses were conducted in several subpopulations, including the “ITT” or “PP” populations by sex, BMI, age, history of alcohol consumption, baseline ALT, baseline liver fat content, and administered dose.

Results

Metabolic pathway and mechanism of action of SNP-630 and SNP-630-MS

When incubated with human whole blood at 37 °C, SNP-630 underwent metabolic processes that led to the formation of four major metabolites (Fig. 1b). The metabolic pathway of SNP-630 is illustrated in Fig. 1a. SNP-630-MS is a mixture of two active metabolites produced by SNP-630 metabolism.

Fig. 1

Metabolic scheme and profile of SNP-630. a Schematic illustration of SNP-630 metabolism. The structures of new chemical entities, SNP-630 and SNP-630-MS, are shown. b Metabolic profiles of SNP-630 (% remaining) and its metabolites (% formation) in human blood

SNP-630 ameliorates HFD-induced hepatic steatosis and inflammation in mice

Considering the induction of CYP2E1 activation and expression in patients with MASLD or MASH [19,20,21,22,23,24,25], we were intrigued by the potential of SNP-630 to inhibit CYP2E1 activity and expression in a mouse model of MASLD. We induced MASH in mice with HFD for 20 weeks and administered SNP-630 orally while continuing the HFD for an additional 10 weeks. After 30 weeks of HFD feeding, mice in the HFD group exhibited an increase in CYP2E1 protein expression; however, treatment with SNP-630 significantly inhibited the protein expression and activity of CYP2E1 (Fig. 2a–c), accompanied with a notable decrease in body weight, liver weight/body weight ratio, and hepatic lipid content (triglycerides, TG and cholesterol, T-CHO) (Fig. 2d–f and Additional File 1b). Histological analysis using H&E staining revealed the presence of cytoplasmic fat vacuoles and droplets in the hepatocytes of mice fed with the HFD diet, whereas mice treated with SNP-630 exhibited smaller fatty droplets and reduced ballooning degeneration in hepatocytes (Fig. 2h, i). Furthermore, SNP-630 treatment significantly decreased cytokine and chemokine monocyte chemoattractant protein 1 and CCL4 expression, further indicating the reduction in hepatic inflammation (Additional File 1c, d). The increase in liver injury biomarkers induced by the HFD was restored by SNP-630, as evidenced by remarkably decreased serum ALT activities (Fig. 2g).

Fig. 2

SNP-630 treatment alleviates HFD-induced hepatic steatosis, inflammation, and fibrosis in the MASH mouse model. a SNP-630 inhibits CYP2E1 catalytic activity. The metabolic ratios of chlorzoxazone (CZX) and its CYP2E1-drived metabolite, 6-hydroxychlorzoxazone (6-OH-CZX), in mice are plotted versus the SNP-630 treatment dose. Data are presented as mean ± SE (n = 8 for each group). b Representative immunoblots of SNP-630 treatment significantly reduced CYP2E1 protein expression. Western blotting of CYP2E1 and β-actin was performed in mouse liver lysates. c Quantification of CYP2E1 protein expression level. d Liver/body weight ratio (e) Liver TG (f) Liver total cholesterol. g ALT h Histopathological analysis of liver tissues. Representative images of Sirius red (left) and H&E (right) staining of livers from the blank group, HFD group, and SNP-630 250 mg/kg group (scale bar: 50 μm). i NAFLD Activity Score (NAS) (j) Hepatic collagen deposition. Fields from Sirius red-stained sections were scanned using a slide scanner (Axio Scan.Z1), and the fibrotic area was measured with digital image analysis using the ImageJ software (k) Representative results of expression of hepatic Col3a1 mRNA. l Representative results of expression of hepatic Timp1 mRNA. Data are expressed as mean ± SEM. Statistical analyses were carried out using a one-way analysis of variance (n = 8/each group). MASH: Metabolic dysfunction-associated steatohepatitis; HFD: high-fat diet

To assess the progression of steatohepatitis in mice, we evaluated the extent of liver fibrosis. Mice fed with HFD exhibited a greater area of fibrils stained with Sirius Red, while treatment with SNP-630 resulted in a significant reduction in hepatic fibrosis in these mice (Fig. 2h, j). Additionally, we examined the expression levels of fibrogenic genes, Co1a1, Col3a1, and Timp1. As depicted in Fig. 2, the expression of these fibrogenic genes was upregulated in mice fed with HFD compared with those fed with a normal diet. Notably, treatment with SNP-630 led to a significant reduction in the expression of these fibrotic genes, further supporting the evidence of reduced liver injury by SNP-630 (Fig. 2j-l and Additional File 1e).

Recently, studies reported the role of LPS from the gut microbiota in favoring the occurrence of MASH. Interestingly, SNP-630 normalized the elevated LPS levels in HFD diet-fed mice (unpublished data).

SNP-630-MS, active metabolites of SNP-630, ameliorates HFD-induced hepatic steatosis and inflammation in mice

Given the rapid conversion of SNP-630 into four active metabolites in vivo, we next determined whether the amelioration of HFD-induced MASH by SNP-630 is mediated through its active metabolites. Two of these active metabolites were synthesized and combined to create SNP-630-MS (Fig. 1a). To assess the hepatoprotective effects of SNP-630-MS in MASH, mice were fed with HFD for 21 weeks. SNP-630-MS significantly reduced the weight gain and protein expression of CYP2E1 (Fig. 3a and Additional File 1a). The levels of liver TG and TCHO were elevated in the HFD group compared with the control group. In contrast, administration of SNP-630-MS resulted in a decrease in liver/body weight ratio, hepatic TG, and TCHO levels in treated mice (Fig. 3b-d). Additionally, the HFD group exhibited elevated ALT levels, whereas mice treated with SNP-630-MS showed significantly reduced ALT levels (Fig. 3e).

Fig. 3

Hepaprotective effects of SNP-630-MS on the HFD-induced mouse model of MASH. MASH was induced in male C57BL/6 mice with HFD for 21 weeks. HFD-induced MASH mice were divided into three groups and received an HFD along with vehicle, 187.5/187.5 (assigned as SNP-630-MS-High), or 62.5/62.5 mg/kg SNP-630-MS (assigned as SNP-630-MS-Low) by oral gavage once daily. Mice on a normal chow diet received the vehicle as the normal control (blank group). a Body weight, b liver/body weight ratio, c liver TG, d liver TCHO, e ALT, f NAS, g fibrosis stage, h expression of hepatic Col3a1 mRNA, and (i) expression of hepatic Timp1 mRNA. Data are expressed as mean ± SEM. Statistical analyses were carried out using a one-way analysis of variance (n = 12/each group). MASH: Metabolic dysfunction-associated steatohepatitis; HFD: high-fat diet

Histological analysis using H&E staining uncovered notable steatosis, inflammation, and hepatic ballooning in the livers of mice fed with HFD, leading to an average NAFLD Activity Score (NAS) of 3.7. Conversely, mice treated with a high dose of SNP-630-MS displayed diminished hepatic steatotic vesicles, inflammation, and ballooning, resulting in an average NAS of 1.3 (Fig. 3f). Furthermore, the fibrosis score was significantly increased in HFD-induced mice compared with those on a chow diet, however, administration of SNP-630-MS dose-dependently attenuated the fibrosis levels and the expression of fibrotic genes Col3a1 and Timp-1 (Fig. 3g-i). These findings suggest that SNP-630-MS inhibited the pathological progression of HFD-induced MASLD by reducing hepatic lipid accumulation, improving NAS, and preventing liver injury.

Long-term application of SNP-630 and SNP-630-MS was safe in mice

The long-term safety of SNP-630 and SNP-630-MS was assessed in mice. No abnormal findings were observed in the liver, kidney, spleen, or heart of mice treated with SNP-630 and SNP-630-MS. Additionally, no diseases or abnormal clinical findings related to the administration of SNP-630 and SNP-630-MS were observed during necropsy studies conducted at the end of the experiment (Data not shown). These findings indicate that both compounds are safe for long-term use.

Clinical trial of SNP-630-MS

Participants and baseline characteristics

This open-label study was initiated at Tri-Service General Hospital, a participating medical center in Taiwan. A total of 90 patients with MASH were screened for enrollment, of which 17 were enrolled in the first arm, receiving two tablets of SNP-630-MS, assigned as high dose group, and 18 in the second arm, receiving one tablet of SNP-630-MS, assigned as low dose group. One patient (5.9%) in the first arm withdrew voluntarily after 3 days of SNP-630-MS dosing. The schematic of the clinical trial progress is presented in Fig. 4.

Fig. 4

SNP-630-MS clinical trial profile. a The disposition of one participant who withdrew after 3 days of dosing cannot be reported. b Analysis of primary efficacy for the modified intention-to-treat (mITT) population. ALT: alanine aminotransferase

The baseline demographics and disease characteristics of the participants were evenly distributed between the two dosing groups, as shown in Table 1. The mean age of the participants was 44.45 years, with 83% being male and a mean body mass index of 30.5 kg/m². Approximately 51.42% of the patients had diabetes or pre-diabetes. All patients met the liver enzyme entry criteria for this study.

Table 1 Demographic and clinical characteristics at baseline

Primary outcome

In the primary efficacy analysis, conducted on the mITT population, those participants were included who had undergone eligible screening and had at least one post-dosing measurement. Patients treated with SNP-630-MS exhibited a dose-dependent reduction in serum ALT levels at week 12 compared with baseline (−29.5 ± 33.0 U/L, P = 0.002 for high-dose SNP-630-MS and −18.9 ± 27.3 U/L, P = 0.009 for low-dose SNP-630-MS). The decrease in serum ALT was observed during the first 8 weeks of SNP-630-MS dosing and sustained throughout the treatment period (Fig. 5a).

Fig. 5

SNP-630-MS met the primary endpoint of improvement in ALT after 12-week treatment in mITT population. a Participants meet the primary endpoint (improvement in ALT). Mean changes from baseline during treatment with two SNP-630-MS tablets (n = 17) and one SNP-630-MS tablet (n = 18) daily for up to 12 weeks. Error bars show standard errors. *P < 0·05, ***P < 0.005 compared with baseline. b Comparison of the FibroScan results at different stages. Mean ± standard deviation (n = 5–12). c Subgroup analyses for the primary endpoint of reduction in ALT levels. Response by baseline fibrosis stage (FibroScan), PNPLA3 genotype, sex, age, BMI, MRI-PDFF, type 2 diabetes, and dose. mITT modified intention-to-treat, PNPLA3 patatin-like phospholipase domain-containing protein 3, BMI body mass index, MRI-PDFF magnetic resonance imaging-proton density fat fraction, ALT alanine aminotransferase

Considering that MASLD is a heterogeneous condition influenced by various factors such as demographics, metabolic status, and genetic predisposition [28], subgroup analyses were conducted to assess the relationship between ALT reduction and these factors (Fig. 5b). After adjusting for all potential confounding variables, a significant association was observed between ALT reduction and SNP-630-MS treatment in all analyzed subgroups, including age group, sex, obesity status, PNPLA3 genotype, fibrosis stage, and diabetes.

Key secondary and exploratory outcomes

Significant reductions in serum AST (−13.1 ± 23.2 U/L, P = 0.034) and lactate dehydrogenase (LDH, −20.2 ± 38.0 U/L, P = 0.044) were observed after 12 weeks of treatment with two tablets of SNP-630-MS (Table 2). Notably, SNP-630-MS treatment significantly improved glycemic control. Fasting serum glucose levels showed a significant reduction (−19.9 ± 30.3 U/L, P = 0.016; Table 2), and there was a slight decrease in insulin levels and HOMA-IR, indicating lower insulin resistance after administration of two tablets of SNP-630-MS at week 12 compared with baseline. Furthermore, SNP-630-MS treatment was associated with significant reductions in both relative and absolute hepatic fat fraction compared with baseline (Table 2). Favorable decreases were also observed in plasma lipid and lipoprotein levels.

Table 2 Demographic and clinical characteristics at baseline and week 12 following SNP-630-MS treatment

Total cholesterol levels decreased by an average of 18.4 mg/dL and triglyceride levels decreased by 37.8 mg/dL in the high-dose group. Finally, participants receiving the higher dose experienced an average reduction of 0.5 kg/m² in BMI (Table 2).

Significant reductions were also observed in the circulating levels of cytokines and chemokines involved in liver inflammation and fibrosis, such as CCL4, CCL5, and caspase 3, after 12 weeks of SNP-630-MS dosing (Table 2). Furthermore, liver stiffness, as measured using FibroScan, showed a significant decrease (P = 0.03) in patients with F4 stage fibrosis who received SNP-630-MS treatment (Fig. 5c). These findings indicate the potential of SNP-630-MS to reduce liver inflammation and fibrosis in patients with MASH.

Safety and tolerability

The safety analysis included all 36 patients with MASH who received at least one dose of the study agent. Adverse events were generally mild and unrelated to the treatment. Throughout the study, a total of four treatment-unrelated adverse events were reported, including acute bronchitis, acute pharyngitis, acute sinusitis, and arthropathy. These adverse events were determined to be of "mild" intensity by the investigators. Importantly, no serious adverse events were reported in this trial as of the writing of this manuscript, indicating the favorable safety profile of the treatment.

Discussion

Despite significant progress in understanding the pathogenesis of MASLD and efforts to develop therapeutic interventions, there remain substantial challenges and no approved treatment for this disease. In recent years, pharmaceutical companies have unsuccessfully attempted to develop effective drugs for MASH, primarily due to a lack of efficacy, toxicity concerns, or a combination of both [29].

Most clinical trials for MASH have traditionally focused on single-agent (monotherapy) approaches. However, considering the complex pathophysiology of the disease and the presence of multiple escape pathways, it is increasingly evident that developing a single drug capable of effectively treating most patients is becoming more challenging and less likely to succeed [30]. As a result, there is growing recognition among drug developers that a single agent or a combination of therapies with different but complementary mechanisms of action may offer the best approach to enhance efficacy, slow disease progression, or even reverse MASH [31]. This shift toward combination therapies is aimed at targeting multiple pathways and achieving synergistic effects to address the heterogeneity of MASH and improve treatment outcomes.

In this study, we conducted a comprehensive investigation to evaluate the therapeutic potential of SNP-630 and its metabolites (SNP-630-MS) with multiple mechanisms in the context of MASH. Initially, we demonstrated that both SNP-630 and SNP-630-MS could effectively inhibit the activity of CYP2E1 enzyme in vivo (Fig. 2a), and expression of CYP2E1 enzyme in animal models of MASH (Fig. 2 b, c and Additional File 1a), subsequently reducing hepatic lipid accumulation, inflammation, and fibrogenesis (Fig. 2). These findings highlight the multifaceted therapeutic effects of SNP-630 and its metabolites, making them promising candidates for the treatment of MASH. Building upon this evidence, we proceeded to administer SNP-630-MS to patients with MASH to confirm the efficacy and safety observed in preclinical studies, further validating the potential of SNP-630 as a therapeutic intervention for MASH.

SNP-630 and its active metabolites possess multiple potential mechanisms of action, specifically targeting the underlying pathogenic pathways implicated in MASH. Studies have elucidated that hepatic DNL, characterized by an abnormal increase in newly synthesized fatty acids in the liver, plays a pivotal role in the development of steatosis and the progression of MASLD [32, 33]. Key regulators involved in this process include SREBP-1c, which controls the transcription of genes related to hepatic triglyceride synthesis, and PPARα, responsible for regulating gene transcription involved in fatty acid esterification and oxidation [34, 35]. Additionally, evidence suggests that CYP2E1, by inhibiting PPARα and enhancing SREBP-1c, can impact fat synthesis and metabolism [36, 37]. Therefore, SNP-630 and its metabolites effectively target these regulatory factors, exerting a modulatory effect on hepatic de novo lipogenesis and associated metabolic pathways. By intervening at these crucial points, SNP-630 and its metabolites demonstrate their potential to mitigate the pathogenesis of MASH and contribute to the management of the disease.

Moreover, the activation of resident hepatic macrophages, known as Kupffer cells, occurs in response to gut-derived LPS, saturated fatty acids, cytokines, and injured hepatocytes and triggers the release of proinflammatory cytokines, such as interleukin-1beta (IL-1β), IL-6, and tumor necrosis factor-alpha (TNF-α), through Toll-like receptor 4 (TLR4) activation [38]. Notably, macrophages exhibiting elevated expression of CYP2E1 show increased levels of CD14 and its co-receptor TLR4, as well as enhanced activation of the transcription factor NF-κB [39]. This increased expression of CYP2E1 primes macrophages, rendering them more responsive to lipopolysaccharide stimuli and leading to heightened production of TNF-α [40, 41]. These findings suggest that SNP-630 and its active metabolites, such as SNP-630-MS, modulate Kupffer cell activation by regulating the activity and expression of CYP2E1. However, further validation is necessary to confirm this hypothesis. Nonetheless, these insights highlight a potential mechanism through which SNP-630 and its metabolites could impact the activation of hepatic macrophages and the subsequent inflammatory response in the context of MASH. Growing investigations held the intestinal barrier dysfunction blame for inflaming the MASLD progression. During the initiation and progression of MASH, large amounts of gut bacterial metabolites and bacterial components such as LPS enter the liver through the portal vein due to the intestinal barrier disruption with the increased intestinal permeability. Mice treated with SNP-630 or SNP-630-MS showed normalized LPS levels compared with HFD control (unpublished data), suggesting that SNP-630 and SNP-630-MS might also improve intestinal function. Further studies are warranted to confirm this speculation.

Furthermore, emerging evidence suggests that adaptive immune mechanisms play crucial roles in the progression of steatosis, insulin resistance, inflammation, and fibrosis in MASH [42, 43]. Experimental models of steatohepatitis and patients with MASH have shown increased recruitment of CD4⁺ and CD8⁺ T cells to the liver [44, 45]. The elevated numbers of CD4 and CD8 T cells in the liver are associated with higher frequencies of IFNγ-expressing CD4 and CD8 T cells in the blood of patients with MASH, respectively [45, 46]. Additionally, plasma levels of IFNγ correlate positively with the presence and size of hepatic lymphocyte aggregates, as well as the severity of fibrosis. Recent studies have suggested that one of the active metabolites of SNP-630 exhibits immunomodulatory effects by limiting T cell proliferation and differentiation [47]. This finding suggests that SNP-630 alleviates MASH by inhibiting T-cell infiltration in the liver, although further confirmation is required. Furthermore, another active metabolite of SNP-630 has a dual regulatory role in promoting fat browning and enhancing lipid homeostasis in cultured white adipocytes [48]. Collectively, these studies provide support for the potential anti-MASH properties of SNP-630 and its active metabolites through the regulation of lipid metabolism, Kupffer cell activation, T-cell infiltration, and intestinal function.

In the present phase 2 trial of patients with MASH, SNP-630-MS, an active metabolite of SNP-630, was utilized as a proof-of-concept. This open-label study evaluated the efficacy of SNP-630-MS in treating MASH. After 12 weeks of treatment, significant anti-inflammatory effects were observed, as evidenced by a substantial decrease in serum ALT levels from baseline (Fig. 5a). The reduction in ALT was –18.9 U/L for SNP-630-MS (one tablet) and –29.5 U/L for SNP-630-MS (two tablets). Interestingly, when compared with Ocaliva from Intercept and Resmetirom from Madrigal, both of which have shown improvement in MASH during phase 3 trials, SNP-630-MS exhibited stronger efficacy in reducing ALT levels and demonstrated better safety and tolerability profiles than these other candidate drugs at a similar stage of development [49, 50].

The predisposition to MASLD is influenced by various genetic polymorphisms. Among these genetic variants, the PNPLA-3 rs738409 C > G (I148C/G-G/G) genotype is considered a common determinant of MASLD [51]. Patients with this genotype are associated with higher liver fat accumulation, increased risk of fibrosis, and reduced benefits from treatments compared with those with the wild-type genotype [52, 53]. In our study, we observed a significant reduction in serum ALT levels after SNP-630-MS treatment specifically in patients with PNPLA3 rs738409 GG or wild-type genotype (Fig. 5b). MASLD often coexists with type 2 diabetes (T2DM), but the impact of T2DM on the efficacy of the drug remains unclear. Subgroup analysis revealed that SNP-630-MS was effective in both patients with and without T2DM (Fig. 5b). Additionally, fasting glucose and HOMA-IR, markers of glucose metabolism, showed significant improvements in patients treated with SNP-630-MS (Table 2). These findings suggest that SNP-630-MS may have potential pharmacological benefits in treating T2DM, although further research is required to fully comprehend its clinical implications.Consistent with the findings from our animal studies (Figs. 2 and 3), SNP-630-MS demonstrated anti-steatosis activity in patients with MASH. Specifically, the low-dose group showed a significant reduction of 14.5% in MRI-PDFF, indicating a decrease in liver fat content (Table 2). However, in the high-dose group, no significant decrease was observed in MRI-PDFF, possibly due to the presence of outliers in the dataset. To address this, we applied the interquartile rule to identify and remove outliers from the data. After eliminating the outliers, we observed a significant reduction of 10.2% in MRI-PDFF in the high-dose SNP-630-MS group. Nevertheless, it is important to note that further experiments are required to validate these results.

Furthermore, SNP-630-MS exhibited strong anti-fibrotic potential by significantly reducing fibrogenesis-related biomarkers. Liver inflammation, which plays a crucial role in fibrosis development, is regulated by CC chemokines that control important chemokine pathways [54]. Notably, treatment with SNP-630-MS resulted in a significant decrease in serum levels of CCL4 and CCL5 in patients with MASH, indicating its effectiveness in suppressing the fibrogenic response (Table 2). Additionally, FibroScan measurements demonstrated the efficacy of SNP-630-MS in improving liver fibrosis. Interestingly, after 12 weeks of SNP-630-MS treatment, there was a significant reduction in liver stiffness (kPa) among patients with a baseline FibroScan fibrosis score of F4, indicating the potential of SNP-630-MS to ameliorate liver fibrosis (Fig. 5c).

SNP-630-MS was generally well tolerated; no SAE was reported in this study. Data on human exposure to each of the components of SNP-630-MS have been well-established and reported in a comprehensive series of toxicological studies. Therefore, the safety issues had already been evaluated and none were expected.

No more than approximately 40% of patients in MASH clinical trials have shown significant benefit from monotherapy [55]. This phenomenon of reduced efficacy can be broadly considered a mechanism of drug resistance. Given that MAFLD is a complex, multifactorial disease with various mechanisms involved, it is unlikely that a single drug will effectively address all its aspects. In this context, thyroid hormone receptor beta (THRβ) agonists, FGF21 analogues, and glucagon-like peptide-1 receptor agonist (GLP-1Ras) exhibit varying degrees of therapeutic benefits for different pathological features of MAFLD and its related metabolic comorbidities [56], For example, FGF21 analogues and THRβ agonists appear to be more potent than GLP-1RAs in amelioration of hepatic steatosis, inflammation and fibrosis, but have minimal effects on obesity, insulin resistance and hyperglycaemia. In contrast, the amelioration in MAFLD by GLP-1RAs is accompanied by obvious improvement in weight loss and glycaemic control. Additionally, compensatory mechanisms might be involved in long-term drug treatment. For instance, Inhibition of ACLY, an enzyme involved in DNL, can be passed in the liver of mice fed a high-fructose diet [57] through upregulation of ACSS2. In addition, CYP4A could serve as a compensatory mechanism in the absence of CYP2E1 [58], which may lead to reduced efficacy in eliminating lipid peroxidation. Therefore, combination of agents might seem a logical approach to increase efficacy, with numerous combinations possible.”

Limitations

Limitations of the present study include its design as a longitudinal trial without a placebo group. To address this limitation, we utilized baseline measurements as a control for comparison. Despite this, significant improvements in anti-inflammatory, anti-steatosis, and anti-fibrotic parameters were observed in patients receiving SNP-630-MS treatment compared to baseline. Another limitation of this study is the lack of liver biopsy results since histological evaluation plays an important role in the development of new drugs for MASH [59]. To achieve a breakthrough in the development of MASH therapeutic drugs, liver biopsies should be required in the trial design. Furthermore, lacking double-blind randomized protocol was also noted in the present study. Therefore, to further confirm the efficacy of SNP-630-MS, additional randomized placebo-controlled studies in patients with biopsy-proven MASH will be conducted in the future.

Conclusion

The findings of this study highlighted the potential of the novel SNP-630 and its metabolites in mitigating hepatic steatosis, MASH injury, and fibrosis through diverse mechanisms in a murine model of MASH. This study provides evidence for the efficacy and safety of SNP-630-MS, the active metabolites of SNP-630, in patients diagnosed with MASH and proposes SNP-630 and its active metabolites as promising candidates for the treatment of MASH. These finding are valuable for researchers aiming to understand pathophysiology and develop new therapies. Additionally, there is potential for the future availability of a unique oral therapy for MASH, which could be significant for patients, providers and caregivers seeking to prevent the progression and complications of this disease.